Синька при стоматите: способы и специфические особенности применения

Содержание

способы и специфические особенности применения

Проблемы ротовой полости встречаются у людей достаточно часто. Одна из распространенных неприятностей – появление белых язвочек на слизистой оболочке. Это – стоматит. Бороться с ним нужно в обязательном порядке. А какие методы лечения предлагают врачи? Что такое синька от стоматита? Об этом и о симптомах стоматита будем говорить подробнее.

Стоматит и его симптомы

Название стоматит пришло из греческого языка. Stoma – означает рот. Симптомы этого заболевания могут быть такими:

  • слизистая оболочка отечная, ее покрывает белый или желтый налет;
  • во рту образовываются белые язвочки разного размера;
  • температура тела – высокая, ее тяжело сбить лекарственными препаратами;
  • могут кровоточить десны;
  • появляется ярко-выраженный неприятный запах.

Слабые, единичные проявления стоматита могут пройти сами, примерно за неделю. Но лучше обратиться к врачу, особенно если страдает маленький ребенок.

Методы лечения стоматита

Очень часто врач говорить пациенту, что поможет синька от стоматита. Но что это? Неужели мы говорим о той синьке, которую бабушки добавляли в белую краску при побелке потолков? Конечно же, нет. Это не бытовая синька, а метиленовый синий или йодистый крахмал. Речь идет о сильном антисептике, нейтрализующем патогенные очаги. Синька от стоматита – не единственный препарат, помогающий бороться с заболеванием, но он по праву считается самым действенным.

Кроме синьки могут быть назначены обезболивающие аппликации на язвы, полоскания или антибиотики (при запущенном состоянии).

Особенности медицинской синьки

Метиленовая синька при стоматите применяется уже много лет. Она вырабатывает нерастворимые соединения с белком патогенного организма. Это соединение вызывает гибель вредной микрофлоры, и человек выздоравливает. Следов от язвочек во рту не остается. Лечение стоматита синькой оправдано еще и тем, что препарат совершенно не попадает в кровоток, когда его наносят на слизистую. Значит печень и другие внутренние органы не страдают.

Как применять препарат взрослым

Поскольку при этом заболевании поднимается высокая температура, то врач назначает жаропонижающие средства. Но это не лечение стоматита, а общие меры безопасности для организма. А вот для лечения назначается синька от стоматита. Инструкция к которой указывает, что взрослый пациент должен многократно обрабатывать пораженный участок слизистой оболочки. Обработка производится до 15 раз в сутки. Обратите внимание: обработку полости рта проводят 1% водным раствором. Не спутайте его со спиртовым метиленовым синим.

Наносится синька от стоматита стерильной ваткой или ватной палочкой. Перед нанесением надо аккуратно промокнуть слюну стерильным материалом.

При многократном воздействии язвочки быстро пропадают, но для полного заживления взрослому пациенту необходимо продолжить обработку успокаивающими средствами. Это может быть облепиховое, льняное масло или масляный раствор витамина А.

Как применять синьку для маленьких пациентов

Синька при стоматите у детей применяется иначе, чем у взрослых. Начнем с того, что малышам нельзя так часто обрабатывать язвочки. Это делают 4 раза в день, после еды.

Если стоматит вызван герпесом, то обработку ротовой полости можно проводить до 5 раз. На слизистых оболочках можно использовать только водный раствор.

Для лечения грудничков синька от стоматита наносится на соски кормящей мамы. Так поступают, чтобы не травмировать нежную слизистую младенца бинтом, тампоном или ватной палочкой.

Медицинский эксперимент

В середине двадцатого века в одном из медицинских институтов России был проведен эксперимент. Была выделена группа из 86 детей от полутора до десяти лет. Дети имели выраженные признаки стоматита. 56 человек имели афтозную форму, 13 — язвенную форму, а у 17 пациентов стоматит возник как аллергия на прием медикаментов.

Детки были полностью обследованы, возбудители стоматита – установлены с помощью лабораторных анализов. Все они прошли курс местного лечения метиленовым синим, но в разных формах.

Младшая группа, в которой были детки от полутора лет, спреем на основе йодистого крахмала. Средняя группа, от двух лет, получала лечение в виде аппликаций. Обработка проводилась ежедневно, первый день в медицинском учреждении, далее дома.

Состояние детей на острой стадии стоматита с высокой температурой и увеличенными лимфатическими узлами после лечением метиленовой синькой улучшалось на третий день, а выздоровление наступало на 6-7 день. Дети с легкой стадией стоматита были полностью здоровы уже через трое суток.

Параллельно медики наблюдали группу детей, которым в поликлинике назначили лечение стоматита антибиотиками. Выздоровление малышей наступало на 9-10 день.

Эксперимент доказал, что лечение стоматита синькой дает высокие результаты. «Водный раствор метиленового синего» был рекомендован для назначения в детских поликлиниках и больницах. Однако по какой-то непонятной причине этот препарат так и не получил заслуженной популярности. Молодые родители предпочитают лечить стоматит у детей новомодными средствами. А на недорогие лекарства из молодости своих мам смотрят с недоверием. Лишает препарат популярности еще и тот факт, что его надо изготавливать в специальных аптеках, а новые лекарства можно просто купить в любой аптечной точке. Однако качественный противовирусный, антибактериальный, противогрибковый, противовоспалительный и ранозаживляющий эффект в одном флаконе может предложить только метиловый синий, то есть медицинская синька.

Синька от стоматита. Как применять ? Эффективность.

Синька от стоматита была популярна 10-20 лет назад. Поэтому, сейчас когда у ребенка обнаруживается стоматит, мамы и, особенно, бабушки часто вспоминают про синьку. Помогает ли синька от стоматита ? Разберемся вместе.

Что такое синька ?

Синька — народное название тиазинового красителя метиленового синего. Синька обладает свойствами антисептика. Для медицинского применения выпускается в виде 1% водного и 1% спиртового раствора и в порошке.

Способы применения

  • Спиртовой раствор применяется только наружно при пиодермии, ветрянке, герпесе, для обработки ран. На слизистые его наносить не рекомендуется.
  • 1 % водный раствор метиленового синего может применяться наружно (наносится на кожу) и местно (наносится на слизистые оболочки).
  • 1 % водный раствор на 25% растворе глюкозы для внутривенного введения — вводится внутривенно медленно при отравлениях сероводородом, угарным газом, цианидами, анилином, нитритами, как антидот.
  • 0,02% водный раствор может применяться для промывания уретры и мочевого пузыря.
  • Порошок метиленового синего принимают внутрь при циститах и уретритах.

Синька от стоматита

Как видно из вышеизложенного, водный раствор синьки можно не только наносить на слизистые, но и даже принимать внутрь и вводить внутривенно, следовательно синька достаточно безопасна.

Синька обладает антисептическими свойствами, а значит убивает вредные микробы и в полости рта.

Поэтому, синьку можно применять при стоматите.

Как применять ?

  • При стоматите можно применять исключительно 1% водный раствор метиленового синего. Спиртовой раствор синьки при стоматите не применяется, т. к. вызывает неприятные ощущения во рту, усиливает боль, может приводить к ожогам слизистой полости рта.
  • 1% водный раствор метиленового синего при стоматите нужно наносить на места поражения (язвочки, пузырьки и т. д.) на слизистой полости рта 5-6 раз в сутки после еды.
  • 1% водный раствор метиленового синего при стоматите разрешен к использованию для детей с момента рождения.

Почему синька от стоматита применяется редко ?

Современные педиатры редко назначают синьку от стоматита, а раньше её использовали часто. Почему ? Потому, что сейчас появились новые, более эффективные средства для лечения некоторых форм стоматита.

Синька при герпетическом стоматите

У детей самая частая разновидность стоматита — герпетический стоматит. Это вирусное заболевание. На вирус герпеса метиленовый синий никакого влияния не оказывает. Он лишь защищает поврежденную слизистую полости рта от вторичного инфицирования микробами. Поэтому, при герпетическом стоматите синьку можно использовать, только как вспомогательное средство в комбинации с противовирусными препаратами (виферон гель, ацикловир и др).

Синька при молочнице

Вторая по частоте форма стоматита у детей — грибковый стоматит или молочница. На грибки метиленовый синий тоже заметного влияния не оказывает. При молочнице применяются раствор буры в глицерине и кандид-раствор для полости рта.

Синька при бактериальном стоматите

Метиленовый синий будет эффективен только при стоматите, вызванном микробами. Это может быть афтозный стоматит или стоматит, возникший после повреждения (ранения) слизистой полости рта. При микробном стоматите метиленовый синий даёт отличный эффект при частом 5-6 р/д нанесении на повреждения в полости рта.

Противопоказания

Синька от стоматита противопоказана тем, у кого имеется индивидуальная непереносимость или аллергия на синьку.

Недостатки 1% водного раствора метиленового синего
  • Метиленовый синий в водном растворе не всегда можно найти в аптеке. Его могут приготовить в рецептурном отделе по рецепту врача, но срок годности такого раствора 10-14 дней.
  • Если Вы вскрыли промышленно изготовленный 1% водный раствор метиленового синего, то срок его хранения после вскрытия флакона — 10-14 дней.
Можно ли приготовить 1% водный раствор синьки дома ?

Можно. И даже — не сложно. 10 г порошка (содержимое 1 флакона с порошком) развести в 1 литре кипяченой или дистиллированной воды. Перемешать, процедить через 4-6 слоев марли. Раствор готов.

Из всего вышеизложенного можно сделать вывод — синька от стоматита может использоваться у детей с рождения, но только по назначению педиатра или стоматолога.
Желаю Вам здоровья!

инструкция по применению раствора синей жидкости для детей и взрослых

Изменено: 26 ноября 2018

Синька от стоматита используется в медицине уже очень давно для местной наружной обработки пораженных участков слизистой оболочки. Благодаря своей эффективности, антисептическое средство актуально и в наше время. В аптечных пунктах препарат можно увидеть под названием «Раствор метиленового синего».

Средство выпускается в трех формах: в виде порошка, на спирту, на воде. Для лечения слизистых оболочек используют только водные растворы. Отсутствие спирта в лекарстве позволяет применять его не только взрослым пациентам, но и при стоматите у детей.

Механизм действия синьки при стоматите

Антисептик метиленовый синий в виде раствора быстро проникает в ткани. При этом они приобретают характерный цвет. Лечебное действие обусловлено возможностью активного вещества связываться с клетками. В этот момент происходит выработка нерастворимых соединений с белками патогенной микрофлоры. Таким образом, синька угнетает бактерии, блокирует размножение вредоносных организмов.

Применение синей жидкости от стоматита не вызывает интоксикации, так как активные компоненты не попадают в кровеносную систему. С уничтожением возбудителей – останавливается инфекционный процесс.

Инструкция по применению синьки при стоматите

Раствор метиленовой сини при стоматите разрешен к применению детям и взрослым людям. Определять способ лечения и продолжительность курса должен только врач.

При этом он учитывает следующие факторы:

  • клиника стоматита;
  • степень тяжести заболевания;
  • возраст пациента.

Обычно в момент острой и хронической стадий назначают обработку всей площади слизистой оболочки. Единичные высыпания можно смазывать точечно.

Инструкция применения синьки от стоматита для взрослых:

  1. Предварительная обработка ротовой полости заключается в удалении белого налета. Для этого оберните указательный палец стерильной марлевой салфеткой, протрите пораженные участки. Предварительно тампон необходимо смочить в содовом растворе (1 ч. л. на стакан воды) или в облепиховом масле.
  2. Если врач назначил обработку всей слизистой оболочки, то протрите ее стерильной салфеткой, смоченной раствором синьки. При точечном способе подразумевается смазывание лекарством только пораженных участков. Используя ватные палочки, обработайте синькой язвочки, захватывая немного здоровой ткани вокруг ран.
  3. Взрослым пациентам врачи рекомендуют проводить процедуры не менее 10 раз в день. В некоторых случаях назначают обработку ран синькой через каждые 1–1,5 часа (но не более 15 раз в сутки).

Стоматит требует комплексного подхода к лечению. Вместе с синькой, пациентам назначают жаропонижающие средства, противовирусные и иммуномодулирующие препараты. Переход на щадящую диету позволит ускорить выздоровление.

Врачи рекомендуют употреблять блюда в теплом виде, мягкой консистенции. Исключают из рациона аллергические продукты и все раздражители (острую, кислую пищу).

При соблюдении всех правил применения синьки облегчение наступает уже на 3–4 сутки. Курс лечения острой формы стоматита составляет неделю. А хроническая стадия требует более длительной обработки (до 20 дней).

Инструкция лечения синькой стоматита у детей несколько отличается. Рассмотрим алгоритм действий:

  1. Назначать применение препарата должен только врач. Прежде всего, ребенка показывают педиатру или стоматологу. Определив тип возбудителя, доктор подбирает эффективную терапию. Дело в том, что сама синька способна уничтожить только бактериальные формы стоматита. Вирусные возбудители нейтрализуют соответствующими препаратами. В этом случае синька выступает вспомогательным лекарством.
  2. Перед использованием препарата необходимо удалить белый налет с пораженных участков. Делайте это таким же способом, как описано выше. Удаляя налет, часто меняйте тампоны. Подробнее про белые десна у грудничка→
  3. Антисептическую жидкость наносят в детском возрасте точечно, используя ватные палочки. Малышам младше 6 лет назначают 2 процедуры в день. Детям старшего возраста разрешено 4 обработки в сутки. Учитывая индивидуальные особенности, доктор может назначить иное количество процедур.
  4. В грудном возрасте обработку при помощи ватных палочек не рекомендуют. Лучше нанести несколько капель синьки на сосок матери перед кормлением. Количество процедур в день назначает врач.

Выздоровления можно добиться только при ежедневном применении препарата. При соблюдении всех рекомендаций доктора, заживление ран происходит уже на 3 день. Полное выздоровление наступает на 6–7 сутки. Хронические стадии стоматита требуют более длительного применения синьки (14–21 день).

Есть ли противопоказания?

При стоматите раствор метиленовой сини применяют уже давно. Это дало возможность изучить все возможные риски и определить наличие противопоказаний. Их немного:

  • индивидуальная непереносимость активного вещества;
  • период беременности и вскармливания грудью ребенка.

Несмотря на гипоаллергенность синьки, в редких случаях она не принимается организмом пациента. Также детям, не достигшим годовалого возраста, препарат назначают с осторожностью.

Возможные побочные эффекты

Синька от стоматита в ходе лечения редко вызывает неприятные последствия. Благодаря особенности препарата не адсорбироваться кровотоком, побочные реакции возникают лишь на фоне индивидуальной непереносимости или передозировки.

Заметив систематические проявления следующих симптомов, необходимо срочно прекратить обработку слизистой оболочки синькой:

  • Головокружение или мигрени.
  • Тошнота, рвота.
  • Проявление психологического дискомфорта (чувство тревоги, нервозность, плаксивость).
  • Нарушается работа мочеполовой системы.
  • Дисфункция желудочно-кишечного тракта.

Также необходимо подготовиться к тому, что синька при стоматите окрашивает зубы и губы в характерный цвет. Поэтому в ходе лечения будет нарушена эстетичность внешнего вида пациента.

Исследования и многолетняя практика доказывают эффективность метиленового синего при стоматите. В большинстве случаев удается быстрее достичь выздоровления, если сравнивать с терапией препаратов антибактериальной группы. К тому же цена лекарства достаточно демократична, что делает его доступным для всех слоев населения.

Автор: Татьяна Гросова, ассистент стоматолога,
специально для Karies.pro

Полезное видео про стоматит у детей

Рейтинг статьи

Синька (метиленовый синий) от стоматита: инструкция по применению, отзывы

Информация носит справочный характер. Не занимайтесь самодиагностикой и самолечением. Обращайтесь ко врачу.

Болезни ротовой полости очень часто встречаются у современного человека и одной из самых распространенных из них является стоматит.

Заболевание сопровождается воспалительным процессом и образованием язвенных поражений на слизистых рта.

При наличии болезни также наблюдаются следующие симптомы:

Метиленовую синьку в борьбе со стоматитом используют уже на протяжении многих лет. Она может вырабатывать нерастворимые с белком соединения, которые способны привести к гибели всей вредной микрофлоры, в результате чего наблюдается процесс выздоровления.

Синька хороша и тем, что при её нанесении на воспаленную слизистую оболочку при стоматите, она никоим образом не попадает в кровоток, что защищает печень и все остальные внутренние органы больного.

Основным активным компонентом данного препарата является метилтиониний хлорид. Это лекарственное средство совершенно не взаимодействует с иными медикаментозными препаратами.

Метиленовый синий можно с легкостью приобрести в любой аптеке города, для покупки лекарства рецепт врача не нужен. В упаковке с препаратом имеется специальная инструкция по применению, которая поможет избежать нежелательного результата.

Как обрабатывать ротовую полость синькой?

Перед использованием синьки необходимо предварительно тщательно ознакомиться с прилагаемой к ней инструкцией, где указано, что в целях лечения стоматита взрослый человек как можно чаще должен обрабатывать пораженную слизистую оболочку данным препаратом.

Обработка должна происходить порядка 15 раз за 1 сутки. Помните, что обрабатывать ротовую полость нужно исключительно 1% раствором.

Наносить лекарственное средство необходимо ватным тампоном либо же ватной палочкой. Прежде чем приступить к нанесению препарата, слизистую оболочку рта следует хорошенько промокнуть от слюны специальным стерильным материалом. В процессе многократного нанесения метиленовой сини на язвочки, ранки быстро начинают исчезать.

Но для того, чтобы полностью избавиться от болезни, взрослый человек должен продолжать обрабатывать полость специальными успокаивающими средствами. С этой целью используются масла льна и облепихи, а также масляный раствор в составе с витамином А.

Очень важно, что после нанесения мителенового синего на язвы, пить и есть в течении получаса категорически запрещено. При активном использовании препарата ранки начнут заживать уже спустя 3-5 дней.

Длительность лечения целиком и полностью зависит от формы развития заболевания, а также сопутствующих недугов и общего состояния иммунной системы.

Учитывая то, что при наличии данного заболевания температура тела больного значительно повышается, то лечащий врач в таком случае назначает некоторые жаропонижающие препараты. Но это никоим образом не является лечением стоматита, а лишь общей мерой безопасности для организма человека.

В процессе лечения слизистые оболочки приобретают синеватый цвет. Но не стоит пугаться, так как метиленовая синь достаточно быстро вымывается.

Важно отметить, что лечение синькой эффективно только при ранних стадиях стоматита.

Использование в педиатрической практике

В отличии от взрослых, лечение синькой стоматита у детей несколько иное. В процессе лечения ребенка не стоит очень часто обрабатывать ранки препаратом. Проводить процедуру следует не более 4 раз в сутки после приема пищи.

В том случае, если возникновение стоматита спровоцировано герпесом, обработка проводится не более 5 раз в день. На слизистых оболочках разрешается использование лишь водного раствора.

Если стоматит наблюдается у грудного ребенка, синьку необходимо наносить на соски кормящей матери. Такой метод используется во избежание травмирования слизистой оболочки малыша ватными палочками, тампонами либо бинтом.

Не синькой едины — что еще можно использовать для лечения стоматита:

Важно помнить!

Метиленовый синий не рекомендуется использовать в следующих случаях:

  • у человека наблюдается индивидуальная непереносимость к компонентам, входящих в состав препарата;
  • не рекомендуется прибегать к использованию средства детям, возраст которых младше 1 года;
  • при беременности, синьку может назначить только лечащий врач, но не в коем случае не стоит прибегать к самостоятельному лечению.

В случае передозировки у больного присутствует покраснение и сильное раздражение слизистой оболочки в области ротовой полости. Столкнувшись с такой проблемой, следует помнить, что лечение синькой следует моментально прекращать.

Точка зрения

Чтобы сформировать окончательно мнение по поводу того, стоит ли вообще пользоваться синькой и насколько она эффективна и безопасна при стоматите, рекомендуем изучить отзывы.

Стоматит не обошел стороной моего пятилетнего ребенка. Конечно же, я сразу вызвала врача на дом, который посоле осмотра назначил мне синий метиленовый.

Я немного засомневалась, но все же решила попробовать. И знаете, я очень благодарна нашему врачу, так как у малыша язвочки начали исчезать буквально на 3 день с момента использования средства. Более того, температура тела сына нормализовалась.

Тем, кто еще не пользовался данным средством рекомендую и хочу сказать, что синька очень хорошо отмывается с тела, но только не с одежды, так что будьте осторожны в процессе применения.

Алиса, 27

У моей супруги тоже возникла такая проблема. Я первый раз увидел ее с синим ртом и очень рассмеялся. Конечно же, она не могла не обидеться. Почему она намазала рот синькой, от самой супруги я так и не узнал (сильно обиделась), решил почитать в Интернете.

Оказывается, она таким образом избавлялась от неприятной болезни. И узнала она это не от посторонних лиц, а от своей бабушки, которая таким образом лечила своих детей и внуков. По истечении 5 дней во рту моей любимой не было ни единой ранки и напоминания о заболевании. Извинялся долго.

Сергей, 30

Я с самого детства страдала стоматитом, и врачи постоянно назначали какие-то медикаментозные препараты, благодаря которым я очень долго избавлялась от недуга. Но в один прекрасный момент мама наткнулась на статью о полезных свойствах метиленового синего. Решили попробовать. Эффект поразил. Уже на 4 день я и думать забыла о болезни. Всем рекомендую.

Марина, 27

Хранить лекарство нужно в труднодоступном для детей месте. Старайтесь, чтобы на препарат не попадали прямые лучи солнца. Хранить синьку можно не более 1 года и только при температуре, которая не превышает 30 градусов.

инструкция по применению метиленового синего раствора для детей, синяя жидкость аптечная для полости рта для ребенка

Синька или раствор метиленового синего – антисептик наружного применения. Используется для лечения грибкового, бактериального, а также герпетического стоматита. Показан для применения лицам старше года. При регулярном применении позволяет добиться стойкого терапевтического эффекта за 3-5 дней. В этом материале мы разберемся, что такое синька, каковы активные компоненты этого средства, их свойства, показания и противопоказания к применению препарата, особенности его использования в различных возрастных группах, возможные побочные эффекты, а также аналоги, представленные на рынке.

Состав и форма выпуска препарата – синька или метиленовый синий раствор

Метиленовый синий раствор (по-другому называется синька) – антисептический раствор, основным действующим компонентом которого является метилтиониния хлорид, вспомогательным компонентом представленного средства является дистиллированная вода. Выпускается он во флаконах емкостью 25 мг.

Раствор представляет собой однородную жидкость синего цвета без осадков. Также в продаже представлена синька в виде порошка для домашнего приготовления раствора, а также раствор синьки на спирту. Препарат отпускается без рецепта.

Для обработки слизистой рта надо использовать водный раствор синьки. Он не раздражает слизистую и подходит даже для детей от года. Жидкость на спиртовой основе может привести к возникновению ожогов на слизистой.

Свойства и применение в медицинских целях

Данный препарат относится к группе антисептиков, назначаемых для наружного применения (действие аналогично Мирамистину или Хлоргексидину от стоматита). Его активное вещество связывает бактериальные клетки, останавливает развитие патогенных организмов. Дополнительно это средство создает на поверхности слизистой защитную пленку, способствующую ускоренной регенерации тканей. Препарат эффективен против большинства патогенных бактерий и при систематическом использовании позволяет лечить такую болезнь, как стоматит, за 5 дней.

Активные компоненты представленного препарата не проникают в кожный кровоток. Это исключает возможность какого-либо токсического воздействия препарата на организм.

Инструкция: показания и противопоказания

Раствор метиленового синего могут назначить при герпетическом, бактериальном либо же грибковом стоматите. Препарат может быть назначен как для лечения острой формы заболевания, так и для купирования хронического воспалительного процесса.

Противопоказаниями к использованию препарата для лечения стоматита являются:

  • повышенная чувствительность к препарату;
  • беременность, кормление грудью;
  • возраст пациента до года.

Ели пациент не знает точно, есть ли у него аллергия на синьку или нет, ему рекомендуется перед применением такого препарата проконсультироваться с врачом. По необходимости медик сделает ему аллергопробу. Если она покажет, что к препарату имеется повышенная чувствительность, его заменят на другое, более безопасное для конкретного пациента средство, например Мирамистин или Хлорофиллипт. Подробней о применении Хлорофиллипта от стоматита читайте в этой статье.

Как пользоваться и правильно разводить жидкость при стоматите

Для лечения стоматита может применяться водный раствор синьки или же порошок для приготовления

водного раствора. Препарат наносят непосредственно на пораженные участки посредством ватного тампона или же ватной палочки. Для усиления эффективности препарата при лечении афтозного стоматита очаги поражения рекомендуется обработать маслом шиповника или персика. Эти средства хорошо снимают с язв налет, чем усиливают действие антисептика. В качестве альтернативы можно использовать и облепиховое масло. Подробности о том, помогает ли облепиховое масло от стоматита смотрите далее.

Срок лечения препаратом составляет от 5 до 10-ти дней, зависит от типа стоматита и общего состояния больного. При правильном применении средства улучшение состояния больного отмечается уже на третьи сутки.

В первые дни лечения заболевания при остром течении стоматита рекомендуется обрабатывать всю ротовую полость. Это позволит остановить развитие инфекции и облегчить состояние больного.

Лечение болезни у взрослых

Пациентам старше 18-ти лет при стоматите рекомендуется использовать раствор метиленового синего только для обработки повреждённых участков слизистой. Работать с этим препаратом им следует так:

  1. Для начала нужно прополоскать рот отваром лекарственных трав, к примеру, ромашки или дуба, чтобы снять налет с афт.
  2. Далее следует промокнуть слизистую, чтобы убрать с нее оставшуюся влагу.
  3. На чистый сухой ватный тампон надо набрать синьку. Обработать ей пораженные участки слизистой, а также близлежащие ткани.

Процедуру нужно повторять не менее 3-х раз в день. Срок лечения средством устанавливает врач.

В течение получаса после применения синьки пациенту нельзя есть и пить. Нарушение этого правила может негативно сказаться на эффективности лечения.

Лекарство детям

Рекомендации по применению синьки для детей зависят от возраста малышей:

  1. Пациентам от года синьку рекомендуется наносить на соску. Это позволяет избежать травм слизистой.
  2. Детям до 3-х лет рекомендуется наносить раствор на пораженные участки слизистой. Манипуляцию нужно повторять 3-4 раза в день.
  3. Детям старше 6-ти лет можно давать синьку в качестве раствора для полоскания.

Детям любого возраста давать синьку нужно строго после кормления. Также нужно следить за тем, чтобы ребенок после обработки полости ничего не брал в рот. В противном случае он может занести инфекцию. Если это случится, вам нужно будет обратиться к стоматологу для повторного обследования и подбора нового лекарства.

Приготовление и правила использования раствора для полоскания

Для полоскания ротовой полости готовят раствор синьки в соотношении 1:5000. Для приготовления препарата для полоскания берут водный раствор синьки. Полоскания проводят после приёма пищи.

Для повышения эффективности препарата перед полосканиями также рекомендуется обрабатывать афты эфирными маслами.

Повторяют данную процедуру 3 раза в день при обычном стоматите. Если у человека отмечен герпетический стоматит, количество полосканий может быть увеличено до 5-ти раз в день. Больше информации о том, чем полоскать рот при стоматите читайте тут.

Следует помнить о том, что синька является красящим веществом. Работать с ней рекомендуется только в перчатках, чтобы не окрасить кожу.

Побочные эффекты

При превышении рекомендованной дозы препарата или повышенной чувствительности человека к активному веществу синька при лечении стоматита может давать побочные эффекты. Чаще всего у пациентов в таких случаях наблюдаются сильное раздражение слизистой и покраснение во рту. Побочные эффекты от данного средства проходят после окончания его применения.

У лиц со сниженным иммунитетом, а также у детей от года при передозировке синькой может наблюдаться расстройство желудка. При появлении такого симптома больным нужно немедленно обратиться к врачу. Он назначит лекарство для купирования этого состояния и заменит синьку другим средством для полоскания.

Аналоги

Если пациенту по каким-то причинам не подходит препарат, его можно заменить аналогами. Таковыми являются:

  • Гидроперит. Таблетки для приготовления антисептического раствора. Используются для полоскания полости рта при стоматитах;

  • Калия перманганат. Антисептическое средство для обработки слизистой;
  • Миристамид. Бесцветная антисептическая жидкость, разрушающая микроорганизмы. Используется при различных формах стоматита;
  • Натрия тетраборат. Прозрачная дезинфицирующая жидкость, используемая в стоматологии, гинекологии, хирургии.

Не следует проводить замену одного препарата на другой самостоятельно. Если вы решите использовать аналог синьки, обязательно обратитесь к врачу, назначившему вам это лекарство, и согласуйте замену с ним.

Видео

Подробности о применении синьки при лечении стоматита смотрите на видео

Выводы

  1. Синька – антисептическое средство, основным действующим компонентом которого является метилтиониния хлорид.
  2. Препарат применяется в стоматологии для лечения бактериального, грибкового, герпетического стоматита.
  3. Основными противопоказаниями к его применению является повышенная чувствительность к средству, беременность, малый возраст пациента.
  4. Для обработки слизистой используют водный раствор синьки. Им обрабатывают пораженные участки рта, а также близлежащие ткани. Также средство используют для полоскания ротовой полости.
  5. Курс лечения синькой составляет от 5 до 10-ти дней. Точный срок лечения определяется врачом с учетом состояния больного, типа стоматита, а также наличия сопутствующих заболеваний. Полоскания можно сочетать с прижиганием проблемных участков. Больше подробностей о том, чем прижечь стоматит читайте тут.

Метиленовый синий при стоматите у детей — ПрофиМед

Как безопасно и эффективно использовать метиленовую синь при стоматите?

Болезни ротовой полости очень часто встречаются у современного человека и одной из самых распространенных из них является стоматит.

При наличии болезни также наблюдаются следующие симптомы:

  • отечность слизистой оболочки с наличием желтого либо беловатого налета;
  • в ротовой полости начинают образовываться язвы, имеющие различные размеры;
  • температура тела больного сильно повышается и сбить ее лекарственными препаратами достаточно сложно;
  • может наблюдаться кровоточивость десен;
  • запах изо рта очень неприятный и достаточно резкий.

Метиленовую синьку в борьбе со стоматитом используют уже на протяжении многих лет. Она может вырабатывать нерастворимые с белком соединения, которые способны привести к гибели всей вредной микрофлоры, в результате чего наблюдается процесс выздоровления.

Синька хороша и тем, что при её нанесении на воспаленную слизистую оболочку при стоматите, она никоим образом не попадает в

кровоток, что защищает печень и все остальные внутренние органы больного.

Основным активным компонентом данного препарата является метилтиониний хлорид. Это лекарственное средство совершенно не взаимодействует с иными медикаментозными препаратами.

Метиленовый синий можно с легкостью приобрести в любой аптеке города, для покупки лекарства рецепт врача не нужен. В упаковке с препаратом имеется специальная инструкция по применению, которая поможет избежать нежелательного результата.

Как обрабатывать ротовую полость синькой?

Перед использованием синьки необходимо предварительно тщательно ознакомиться с прилагаемой к ней инструкцией, где указано, что в целях лечения стоматита взрослый человек как можно чаще должен обрабатывать пораженную слизистую оболочку данным препаратом.

Обработка должна происходить порядка 15 раз за 1 сутки. Помните, что обрабатывать ротовую полость нужно исключительно 1% раствором.

Наносить лекарственное средство необходимо ватным тампоном либо же ватной палочкой. Прежде чем приступить к нанесению препарата, слизистую оболочку рта следует хорошенько промокнуть от слюны специальным стерильным материалом. В процессе многократного нанесения метиленовой сини на язвочки, ранки быстро начинают исчезать.

Но для того, чтобы полностью избавиться от болезни, взрослый человек должен продолжать обрабатывать полость специальными успокаивающими средствами. С этой целью используются масла льна и облепихи, а также масляный раствор в составе с витамином А.

Очень важно, что после нанесения мителенового синего на язвы, пить и есть в течении получаса категорически запрещено. При активном использовании препарата ранки начнут заживать уже спустя 3-5 дней.

Длительность лечения целиком и полностью зависит от формы развития заболевания, а также сопутствующих недугов и общего состояния иммунной системы.

Учитывая то, что при наличии данного заболевания температура тела больного значительно повышается, то лечащий врач в таком случае назначает некоторые жаропонижающие препараты. Но это никоим образом не является лечением стоматита, а лишь общей мерой безопасности для организма человека.

В процессе лечения слизистые оболочки приобретают синеватый цвет. Но не стоит пугаться, так как метиленовая синь достаточно быстро вымывается.

Важно отметить, что лечение синькой эффективно только при ранних стадиях стоматита.

Использование в педиатрической практике

В отличии от взрослых, лечение синькой стоматита у детей несколько иное. В процессе лечения ребенка не стоит очень часто обрабатывать ранки препаратом. Проводить процедуру следует не более 4 раз в сутки после приема пищи.

В том случае, если возникновение стоматита спровоцировано герпесом, обработка проводится не более 5 раз в день. На слизистых оболочках разрешается использование лишь водного раствора.

Если стоматит наблюдается у грудного ребенка, синьку необходимо наносить на соски кормящей матери. Такой метод используется во избежание травмирования слизистой оболочки малыша ватными палочками, тампонами либо бинтом.

Не синькой едины — что еще можно использовать для лечения стоматита:

Важно помнить!

Метиленовый синий не рекомендуется использовать в следующих случаях:

  • у человека наблюдается индивидуальная непереносимость к компонентам, входящих в состав препарата;
  • не рекомендуется прибегать к использованию средства детям, возраст которых младше 1 года;
  • при беременности, синьку может назначить только лечащий врач, но не в коем случае не стоит прибегать к самостоятельному лечению.

В случае передозировки у больного присутствует покраснение и сильное раздражение слизистой оболочки в области ротовой полости. Столкнувшись с такой проблемой, следует помнить, что лечение синькой следует моментально прекращать.

Точка зрения

Чтобы сформировать окончательно мнение по поводу того, стоит ли вообще пользоваться синькой и насколько она эффективна и безопасна при стоматите, рекомендуем изучить отзывы.

Стоматит не обошел стороной моего пятилетнего ребенка. Конечно же, я сразу вызвала врача на дом, который посоле осмотра назначил мне синий метиленовый.

Я немного засомневалась, но все же решила попробовать. И знаете, я очень благодарна нашему врачу, так как у малыша язвочки начали исчезать буквально на 3 день с момента использования средства. Более того, температура тела сына нормализовалась.

Тем, кто еще не пользовался данным средством рекомендую и хочу сказать, что синька очень хорошо отмывается с тела, но только не с одежды, так что будьте осторожны в процессе применения.

Алиса, 27

У моей супруги тоже возникла такая проблема. Я первый раз увидел ее с синим ртом и очень рассмеялся. Конечно же, она не могла не обидеться. Почему она намазала рот синькой, от самой супруги я так и не узнал (сильно обиделась), решил почитать в Интернете.

Оказывается, она таким образом избавлялась от неприятной болезни. И узнала она это не от посторонних лиц, а от своей бабушки, которая таким образом лечила своих детей и внуков. По истечении 5 дней во рту моей любимой не было ни единой ранки и напоминания о заболевании. Извинялся долго.

Сергей, 30

Я с самого детства страдала стоматитом, и врачи постоянно назначали какие-то медикаментозные препараты, благодаря которым я очень долго избавлялась от недуга. Но в один прекрасный момент мама наткнулась на статью о полезных свойствах метиленового синего. Решили попробовать. Эффект поразил. Уже на 4 день я и думать забыла о болезни. Всем рекомендую.

Марина, 27

Хранить лекарство нужно в труднодоступном для детей месте. Старайтесь, чтобы на препарат не попадали прямые лучи солнца. Хранить синьку можно не более 1 года и только при температуре, которая не превышает 30 градусов.

Мама — доктор. Для любого ребенка — лучший доктор — мама.

Сайт для любящих мам.

Синька от стоматита

Синька от стоматита была популярна 10-20 лет назад. Поэтому, сейчас когда у ребенка обнаруживается стоматит, мамы и, особенно, бабушки часто вспоминают про синьку. Помогает ли синька от стоматита ? Разберемся вместе.

Что такое синька ?

Синька — народное название тиазинового красителя метиленового синего. Синька обладает свойствами антисептика. Для медицинского применения выпускается в виде 1% водного и 1% спиртового раствора и в порошке.

Способы применения

  • Спиртовой раствор применяется только наружно при пиодермии, ветрянке, герпесе, для обработки ран. На слизистые его наносить не рекомендуется.
  • 1 % водный раствор метиленового синего может применяться наружно (наносится на кожу) и местно (наносится на слизистые оболочки).
  • 1 % водный раствор на 25% растворе глюкозы для внутривенного введения — вводится внутривенно медленно при отравлениях сероводородом, угарным газом, цианидами, анилином, нитритами, как антидот.
  • 0,02% водный раствор может применяться для промывания уретры и мочевого пузыря.
  • Порошок метиленового синего принимают внутрь при циститах и уретритах.

Синька от стоматита

Как видно из вышеизложенного, водный раствор синьки можно не только наносить на слизистые, но и даже принимать внутрь и вводить внутривенно, следовательно синька достаточно безопасна.

Синька обладает антисептическими свойствами, а значит убивает вредные микробы и в полости рта.

Поэтому, синьку можно применять при стоматите.

Как применять ?

  • При стоматите можно применять исключительно 1% водный раствор метиленового синего. Спиртовой раствор синьки при стоматите не применяется, т. к. вызывает неприятные ощущения во рту, усиливает боль, может приводить к ожогам слизистой полости рта.
  • 1% водный раствор метиленового синего при стоматите нужно наносить на места поражения (язвочки, пузырьки и т. д.) на слизистой полости рта 5-6 раз в сутки после еды.
  • 1% водный раствор метиленового синего при стоматите разрешен к использованию для детей с момента рождения.

Почему синька от стоматита применяется редко ?

Современные педиатры редко назначают синьку от стоматита, а раньше её использовали часто. Почему ? Потому, что сейчас появились новые, более эффективные средства для лечения некоторых форм стоматита.

Синька при герпетическом стоматите

У детей самая частая разновидность стоматита — герпетический стоматит. Это вирусное заболевание. На вирус герпеса метиленовый синий никакого влияния не оказывает. Он лишь защищает поврежденную слизистую полости рта от вторичного инфицирования микробами. Поэтому, при герпетическом стоматите синьку можно использовать, только как вспомогательное средство в комбинации с противовирусными препаратами (виферон гель, ацикловир и др).

Синька при молочнице

Вторая по частоте форма стоматита у детей — грибковый стоматит или молочница. На грибки метиленовый синий тоже заметного влияния не оказывает. При молочнице применяются раствор буры в глицерине и кандид-раствор для полости рта.

Синька при бактериальном стоматите

Метиленовый синий будет эффективен только при стоматите, вызванном микробами. Это может быть афтозный стоматит или стоматит, возникший после повреждения (ранения) слизистой полости рта. При микробном стоматите метиленовый синий даёт отличный эффект при частом 5-6 р/д нанесении на повреждения в полости рта.

Противопоказания

Синька от стоматита противопоказана тем, у кого имеется индивидуальная непереносимость или аллергия на синьку.

Недостатки 1% водного раствора метиленового синего
  • Метиленовый синий в водном растворе не всегда можно найти в аптеке. Его могут приготовить в рецептурном отделе по рецепту врача, но срок годности такого раствора 10-14 дней.
  • Если Вы вскрыли промышленно изготовленный 1% водный раствор метиленового синего, то срок его хранения после вскрытия флакона — 10-14 дней.
Можно ли приготовить 1% водный раствор синьки дома ?

Можно. И даже — не сложно. 10 г порошка (содержимое 1 флакона с порошком) развести в 1 литре кипяченой или дистиллированной воды. Перемешать, процедить через 4-6 слоев марли. Раствор готов.

Из всего вышеизложенного можно сделать вывод — синька от стоматита может использоваться у детей с рождения, но только по назначению педиатра или стоматолога.
Желаю Вам здоровья!

  1. Чем мазать стоматит ?Чем мазать стоматит ? Точнее чем можно мазать рот ребенку.
  2. Сода ребенкуСода ребенку может применяться при болезнях горла, стоматите, зубной боли.
  3. Молочница у новорожденногоМолочница у новорожденного, одна из самых частых проблем, с которыми.
  4. Стоматит у ребенка Герпетический Афтозный Молочница Заеды Лечение стоматитовСтоматит у ребенка — очень частая и неприятная проблема. Что.
  5. Чем мазать ветрянку ?Чем мазать ветрянку ? Среди вопросов, на которые приходится отвечать.

Синька против стоматита: способы применения и возможные побочные эффекты

Раствор метиленового синего, больше известный в широких массах как синька, является эффективным антисептическим средством.

Он обладает отличным бактерицидным и ранозаживляющим действием, поэтому его часто используют при лечении стоматита в домашних условиях.

Отсутствие спирта в составе исключает вероятность отравлений или ожогов слизистой. При лечении синькой медицинской, инструкция которой подробно описывает показания и противопоказания, следует обратить внимание на возможные побочные действия.

Особенности препарата

Основным действующим компонентом медицинской синьки является метилтиония хлорид. Дополнительным веществом выступает дистиллированная вода.

Механизм действия заключается в способности антисептика соединяться с патогенными бактериями и нейтрализовать их пагубное воздействие. В итоге в полости рта уничтожаются все вредные микробы.

Синька от стоматита (отзывы об эффективности препарата довольно впечатляющие) применяется местно на поврежденную кожу (в том числе и слизистую оболочку), и поскольку он не проникает в кровь, то не может вызвать токсические отравления. А значит, печень и другие органы не могут пострадать.

Метиленовая синька при стоматите применяется в виде 1% водного раствора, который не вызывает неприятного ощущения во рту и не приводит к ожогам слизистой.

И внутривенно, и наружно

Свойства метиленового синего позволяют использовать его в различных областях медицины наружно и внутривенно. Он представляет собой кристаллический порошок, из которого можно приготовить спиртовой или водный раствор.

Медицинская синька рекомендуется к применению в качестве местного средства в следующих случаях:

  • при различных повреждениях кожного покрова – наружно путем смазывания участков спиртовым раствором;
  • как антисептик для промывания зараженных полостей;
  • при воспалениях слизистых оболочек или кожного покрова;
  • синьку используют при мочеполовых заболеваниях непосредственно для промывания уретры.

Внутривенно медицинская синька назначается:

  • для диагностирования или лечения почечных патологий;
  • при отравлениях сероводородом, угарным газом или цианистыми соединениями синька используется в качестве антидота;
  • внутрь препарат назначается при лечении цистита или уретрита;
  • инъекции синьки медицинской в комплексе с новокаином делаются внутримышечно при хроническом дерматозе.

Как применять препарат?

Синька от стоматита (цена, к слову, данного препарата самая что ни есть демократичная) разрешена к применению взрослым и детям, начиная с рождения.

При таком заболевании, как стоматит, лечение синькой зависит от клинических особенностей, степени тяжести недуга и возраста пациента.

Хронический или острый стоматит лечится путем обрабатывания всей слизистой оболочки рта.

Перед использованием синьки медицинской следует удалить белый налет при помощи тампона, смоченного в облепиховом, льняном или персиковом масле. После ватный диск смачивают в 1% водном растворе и закладывают в ротовую полость.

Эффективность синьки медицинской проверена годами. Такое антисептическое средство способствует снятию воспаления и предотвращает от повторного заражения. При острой форме курс лечения составляет до 7 дней, а при хронической – до 3 недель. Раствор необходимо применять до полного устранения язвочек.

Перед определением терапевтического курса специалист осматривает ротовую полость и ставит окончательный диагноз. При стоматите назначается комплексная терапия, включающая противовирусные и жаропонижающие препараты, а также обработку синькой медицинской.

Частота обрабатывания ротовой полости лекарственным средством зависит от:

  • тяжести и формы заболевания;
  • состоянии иммунной системы;
  • наличия дополнительных патологий.

Так, взрослым пациентам рекомендуется проводить очистку пораженных участков не менее 10-15 раз в сутки.

При остром стоматите на начальных этапах синькой обрабатывается вся ротовая полость. По мере улучшения состояния препарат следует наносить точечно при помощи ватной палочки. Это поможет избежать появления раздражения слизистой оболочки.

Синька при стоматите у детей назначается только лечащим врачом (стоматологом или педиатром).

Из-за отсутствия способности накопления в крови, она разрешается даже новорожденным детям.

Метиловый синий оказывает эффективное действие только при бактериальном стоматите, который вызывают различные микробы.

В этом случае на повреждения ротовой полости препарат нужно наносить точечно. Обрабатывать пораженные участки детям до 6 лет следует 2 раза в сутки, а старшего возраста – 4 раза.

Одним из часто встречающихся видов стоматита в детском возрасте является герпетический. Но это вирусное заболевание не лечится при помощи синьки медицинской. Поэтому препарат можно использовать в качестве дополнения к основной терапии, которая основывается на приеме противовирусных препаратов. Синька же поможет защитить полость рта от повторного заражения микробами.

Прицельное применение в стоматологии

Метиленовый синий в стоматологии выступает в качестве эффективного антивоспалительного средства и антисептика.

Его применяют в случае развития в ротовой полости бактериальной, грибковой или вирусной инфекции. Водным раствором можно обрабатывать как поврежденные участки слизистой оболочки, так и здоровые ткани без риска их повреждения.

Синька при лечении стоматологических заболеваний назначается в зависимости от клинической картины и поставленного врачом диагноза, выделяются следующие схемы лечения:

  • при стоматите производятся точечные прижигания язвочек 1% водным раствором. Таким образом, на поврежденной поверхности образуется защитная пленка, при помощи которой ускоряется регенерация тканей. Частота обработки определяется врачом, она зависит от возраста пациента и стадии заболевания;
  • при гингивите пораженные участки слизистой десен смазываются 1% водным раствором;
  • для лечения молочницы синька является незаменимым средством, которое вызывает гибель патогенной микрофлоры и предотвращает повторное возникновение проблемы. Кратность обработки зависит от тяжести процесса.

Возможность побочных действий

Метиловый синий, как и любой лекарственный препарат, имеет противопоказания к применению.

Метиленовая синька не рекомендована к применению в случае:

  • индивидуальной непереносимости или аллергических реакциях на один или нескольких компонентов лекарственного средства;
  • во время беременности или кормления препарат можно использовать только в случае, если польза для матери от использования будет больше, чем возможного вреда малышу;
  • при стоматите у ребенка в возрасте до года, синьку следует наносить осторожно, точечно и только с разрешения врача.

Поскольку попасть в кровь синька не может, то побочные действия могут возникнуть на фоне передозировки или из-за компонентов самого препарата.

Среди возможных системных проявлений выделяются:

  • головная боль;
  • снижение аппетита;
  • кожные аллергические реакции;
  • тошнота или рвота;
  • анемия;
  • нарушения в работе мочеполовой системы;
  • психологический дискомфорт;
  • расстройства со стороны пищеварительной системы.

Специалисты отмечают, что риск возникновения отрицательных реакций увеличивается, если обрабатывать большие участки слизистой оболочки рта.

Видео по теме

Где купить синьку от стоматита? Здесь все просто: препарат продается практически в каждой аптеке. Также рекомендуем познакомиться с не менее эффективными способами борьбы со стоматитом в домашних условиях:

На основе многолетних наблюдений было замечено, что синька при лечении стоматита дает очень высокие результаты. Благодаря широкому спектру действий средство рекомендовано во всех детских больницах.

Источники:

http://dentazone.ru/preparaty-oborudovanie/medikamenty/sinka-pri-stomatite.html
http://mamadoktor.ru/38-284/sinka-ot-stomatita.html
http://zubki2.ru/drugie-zabolevaniya/stomatit/sinka-medicinskaya-instrukciya.html

применение метиленового синего по инструкции

Стоматит возникает по разным причинам и имеет весьма неприятные проявления. В ротовой полости появляется налет, могут возникать болезненные язвочки, неприятный запах. Человеку становится трудно принимать пищу и даже разговаривать. Методы лечения заболевания включают в себя применение различных препаратов. Одним из них является метиленовый синий, или проще говоря – медицинская синька.

Откуда берется стоматит

Медики делят стоматит на 4 категории в зависимости от причин его появления:

  • Инфекционный стоматит часто сопровождает воспалительные заболевания верхних дыхательных путей и вызывается распространением вблизи очага инфекции патогенных микроорганизмов. Так, при тонзиллите или гриппе вполне возможно проявление стоматита. Способствует этому пониженный во время основной болезни иммунитет.
  • Второй тип стоматита – травматический. Язвочки часто возникают на месте травмы или ожога слизистой рта. В ранку проникает инфекционный агент и начинает развиваться воспаление.
  • Симптоматическим называют стоматит, который является симптомом заболеваний различных органов и систем. Воспаление в полости рта может стать следствием проблем с ЖКТ, патологий сердечно-сосудистой или эндокринной системы.
  • Специфический стоматит возникает как следствие аллергии на медицинские препараты, в результате поражения грибком, при отравлениях, сифилисе или туберкулезе.

Стоматит может проявляться катаральными явлениями, то есть в виде отека слизистой и появление на ней желтоватого налета, повышенного слюноотделения. Язвенная форма распространяется на всю толщину слизистой и сопровождается сильной болезненностью. Бывает, что стоматит проявляется появлением афт – круглых или овальных очагов воспаления с желтоватым налетом в центре и красной окантовкой. Афтозный стоматит может иметь как отдельные, так и сгруппированные воспалительные очаги.

Метиленовый синий

Что такое синька и почему ею лечат стоматит? Этот препарат применяется в лечении стоматитов у взрослых и детей многие десятилетия. Средство является недорогим, но эффективным, что было доказано экспериментальными медицинскими исследованиями, проведенными еще в середине прошлого столетия.

Несмотря на положительный результат эксперимента по определению эффективности метиленового синего в лечении стоматитов различного происхождения, широкого распространения этот способ лечения так и не получил. Сегодня врачи назначают пациентам дорогие «раскрученные» препараты, в то время как помочь может дешевая медицинская синька.

Для лечения стоматита используют водный раствор, состоящий из метилтиониния хлорида и очищенной воды. В продаже имеются флаконы по 25, 50 и 100 мл. Согласно данным инструкции препарат сохраняет свои свойства в течение 3-х лет. Хранить его необходимо в затемненном месте.

Свойства метиленового синего

Средство обладает антисептическим действием, а также восстанавливает окислительные процессы в организме и служит противоядием против некоторых видов яда. К гибели бактерий метиленовый синий приводит в результате соединения с белками патогенных возбудителей. Местное нанесение исключает попадание препарата в общий кровоток и последующее вредное воздействие. При уретрите и цистите препарат используют для спринцеваний.

Особенностью метиленовой синьки является свойство сильно окрашивать любые поверхности, поэтому все манипуляции с ней необходимо проводить в защитных перчатках. Обработанные участки слизистой также станут синего цвета, это нормально. Тактику применения выбирают исходя из остроты симптомов и общей клинической картины заболевания.

Применение у взрослых

Перед применением синьки необходимо проконсультироваться с врачом и получить его назначения. Иногда препарат является единственным компонентом терапии, бывает, что его включают в состав комплексного лечения, назначая параллельно антибиотики и жаропонижающие средства.

  • Перед применением синьки воспалительные очаги протирают льняным, облепиховым или оливковым маслом. Это можно сделать при помощи ватной палочки или ватного диска.
  • После этого наносят саму синьку, пользуясь чистой ватной палочкой. Наносить препарат нужно точечно, только в местах воспаления.
  • У взрослых процедуру применяют по возможности часто, до 15 раз в день, ведь лекарство быстро смывается во рту.

Через три дня уже будет видимый результат, язвы начнут заживать. При хроническом процессе лечение синькой от стоматита может затянуться до 3-х недель.

Применение у детей

Способ лечения стоматита медицинской синькой у детей почти не отличается от той же процедуры у взрослых. Меньше только кратность обработки.

Первоначально пораженные места смазывают маслом для удаления микробного налета, а затем уже точечно наносят метиленовый синий. У детей до года средство не применяют, малышам от года до 6-х лет обработку проводят дважды в день. Более старшим детям синьку наносят 4 раза в сутки.

Побочные эффекты и противопоказания

Препарат может вызывать в процессе применения аллергические реакции, проявляющиеся сыпью, покраснением, чувством жжения и зудом. Но поскольку синька наносится точечно и в небольших количествах, такого осложнения обычно не возникает. При возникновении аллергии препарат отменяют и снимают симптомы антигистаминными средствами.

К противопоказаниям относят младенческий возраст и индивидуальную непереносимость метиленового синего. Какие-то особенности взаимодействия препарата с другими лекарственными средствами не выявлены.

(A) Распространенность мукозита/стоматита (синяя (онлайн) кривая)….

Контекст 1

… из 89 пациентов, включенных в группу регорафениба, 36 пациентов страдали мукозитом/стоматитом до прогрессирования; наихудшая степень токсичности была 2 у 17 больных. Рисунок 2А (синяя кривая) представляет вероятность мукозита/стоматита (степень 2) при условии, что он жив и не прогрессирует с течением времени. Максимальное значение расчетной распространенности составило 13,1% через 1,5 мес….

Контекст 2

… у 45 пациентов, не страдающих мукозитом/стоматитом 2-й степени, была снижена или прекращена доза по крайней мере один раз до прогрессирования заболевания, при этом самая низкая введенная доза составляла 80 мг для 13 пациентов. На рисунке 2А представлена ​​распространенность мукозита/стоматита (степень 2) или снижение доз с течением времени (оранжевый: менее 160 мг, зеленая точка: менее 120 мг) при условии, что они живы и не прогрессируют. В течение первых 3 мес распространенность пациентов с НЯ или РЗ <160 мг увеличилась до 62.8% и был оценен в 80,0% через 6 месяцев (рис. 2А, оранжевый). ...

Контекст 3

… 2A представляет распространенность мукозита/стоматита (степень 2) или снижение доз с течением времени (оранжевый: менее 160 мг, зеленая точка: менее 120 мг) при условии живой и без прогрессии. В течение первых 3 месяцев распространенность пациентов с НЯ или РЗ <160 мг увеличилась до 62,8% и оценивалась в 80,0% через 6 месяцев (рис. 2А, оранжевый). Распространенность AE или RD <120 мг (рис. 2A, зеленые точки) оценивалась в 26.9% через 1 месяц, а затем колебались от 18,5% (2,0 месяца) до 46,4% (5,1 месяца). ...

Контекст 4

… первые 3 месяца распространенность пациентов с НЯ или RD <160 мг увеличилась до 62,8% и оценивалась в 80,0% через 6 месяцев (Рисунок 2А, оранжевый). Распространенность AE или RD <120 мг (рис. 2A, зеленые точки) оценивалась в 26,9% через 1 месяц, а затем колебалась от 18,5% (2,0 месяца) до 46,4% (5,1 месяца). Индивидуальная распространенность представлена ​​на рисунках 2C и D.Со временем увеличилась распространенность пациентов без мукозита/стоматита 2 и с дозой <160 мг (состояние 2). ...

Контекст 5

… AE или RD <120 мг (рис. 2A, зеленые точки) оценивалось в 26,9% через 1 месяц, а затем колебалось от 18,5% (2,0 месяца) до 46,4% ( 5,1 месяца). Индивидуальная распространенность представлена ​​на рисунках 2C и D. Распространенность пациентов без мукозита/стоматита 2 и с дозой <160 мг (состояние 2) увеличивалась с течением времени. При дозе 80 мг или прекращении лечения распространенность НЯ и/или РЗ оставалась стабильной с течением времени через 3 месяца....

Контекст 6

… 3 месяца, 30,2% пациентов живы, без прогрессирования и без мукозита/стоматита 2 получали лечение в дозе 120 мг; 27,9% прекратили лечение или получили дозу 80 мг. Чтобы отличить данные от индивидуальной распространенности трех состояний, мы присвоили каждому состоянию различный вес и рассчитали распространенность мукозита/стоматита или РЗ (рис. 2В). Как распространенность НЯ, так и/или снижение дозы (<160 мг), а также частота встречаемости со временем увеличиваются....

Структура комплекса N0-P вируса везикулярного стоматита

Рисунок 5

Поверхностные свойства и консервация аминокислот в сайте связывания P.

(A) Крупный план интерфейса между не содержащим РНК N Δ21 и P 60 , демонстрирующий гидрофобные контакты и солевые мостики. Остатки с 17 по 31 P 60 укладываются в амфипатическую α-спираль, которая находится в гидрофобной полости, образованной остатками шарнирной области N, и стабилизируется гидрофобными контактами с участием остатков P 60 , расположенных на расстоянии i+3 или i +4 (Леу 17 , Вал 21 , Иле 24 и Иле 27 ).Tyr 14 пристыковывается к небольшой полости, выстланной гидрофобными остатками. Гидрофобные боковые цепи N окрашены в желтый цвет, а гидрофобные боковые цепи P 60 помечены. Комплекс также стабилизирован солевыми мостиками между Asp 25 из P 60 и Arg 312 и His 233 из N (синий) и между Arg 16 из P 60 и Asp N (красным цветом). (B) Сохранение аминокислотной последовательности между VSV и RAV N.Идентичные остатки показаны темно-синим цветом, а аналогичные остатки показаны светло-синим цветом. Площадь поверхности, обведенная черным, показывает бороздку связывания P, а площадь поверхности, обведенная красным, показывает гидрофобный сайт, общий как для P, так и для оснований на 3′-конце РНК. (C, D) Электростатический поверхностный потенциал белка N Δ21 0 (C) по сравнению с потенциалом комплекса N Δ21 0 -P 60 (D). Обе панели показывают в одинаковых ориентациях две стороны белка N Δ21 0 , участвующего в связывании MoRE P.Стрелки указывают области, в которых электростатический поверхностный потенциал N изменяется в присутствии пептида. Поверхностные потенциалы были рассчитаны с помощью программы Delphi и обозначены цветом на поверхности от красного (отрицательно заряженные остатки, -7 ккал/моль) до синего (положительно заряженные остатки, +7 ккал/моль).

doi: https://doi.org/10.1371/journal.ppat.1002248.g005

Генетически сконструированный вирус везикулярного стоматита в генной терапии: применение для лечения злокачественных заболеваний 3, 27).Сообщалось, что способность VSV размножаться в опухолевых клетках частично обусловлена ​​дефектной системой интерферона (IFN) (2, 25). Поскольку система IFN функционирует в нормальных клетках, предотвращается эффективная репликация VSV, который является чувствительным к IFN вирусом. Основываясь на наблюдениях in vitro и in vivo, было продемонстрировано, что VSV эффективно реплицируется и лизирует инфицированные раковые клетки, оставляя относительно незатронутыми нормальные клетки (2, 3, 25). Действительно, использование VSV в качестве онколитического агента имеет несколько преимуществ по сравнению с другими системами доставки вирусов, используемыми в настоящее время в терапии опухолей, такими как аденовирусы и ретровирусы (24).Прежде всего, VSV не обладает известными трансформирующими способностями (27). Во-вторых, ген VSV не аттенуирован, что влияет на репликацию и, следовательно, на онколитическую противоопухолевую активность (10). В-третьих, оболочечный гликопротеин VSV обладает высокой тропностью в отношении ряда типов клеток и должен быть эффективен при нацеливании на различные ткани in vivo. Таким образом, гликопротеин оболочки VSV был использован при создании ряда псевдотипированных вирусов с целью повышения эффективности трансдукции образующихся агентов (11).В-четвертых, VSV, по-видимому, способен реплицироваться в большом количестве онкогенных клеток, а не, например, в клетках, дефектных только по селективным генам-супрессорам опухолей, таким как p53 (3, 10). В связи с этим, недавние исследования in vivo показали, что VSV способен сильно проявлять свою онколитическую активность в опухолях с дефектами путей Ras, Myc и p53, клеточных аберраций, которые встречаются более чем в 90% всех опухолей (3). Наконец, возможность модифицировать VSV с помощью генной инженерии дает возможность разработки новых поколений заказных векторов VSV, содержащих иммуномодулирующие и/или суицидные кассеты, предназначенные для повышения их противоопухолевой активности.Однако на сегодняшний день не сообщалось о создании и оценке рекомбинантных VSV для использования в терапии рака. Поэтому, чтобы начать оценивать, могут ли быть созданы генно-инженерные VSV, несущие иммуномодулирующие/суицидальные гены, и, во-вторых, являются ли такие вирусы более эффективными в терапии опухолей, чем VSV дикого типа, мы попытались разработать векторы VSV, несущие тимидинкиназу вируса герпеса. ТК) суицидальной кассеты или ген цитокина интерлейкина 4 (ИЛ-4). Известно, что механизм действия ТК включает белок ТК, фосфорилирующий нетоксичное пролекарство ганцикловир (GCV), которое встраивается в клеточную ДНК во время репликации, что приводит к обрыву цепи и гибели клеток (17).Однако сообщалось, что суицидальный подход TK/GCV имеет дополнительные преимущества, заключающиеся в том, что модифицированные TK могут напрямую передаваться от трансдуцированной клетки к соседним клеткам, тем самым увеличивая уничтожение опухоли, явление, известное как «эффект свидетеля». Активность IL-4, напротив, включает влияние на развитие эффекторных клеток, таких как эозинофилы и антигенпрезентирующие клетки (APC) (8). Также известно, что ИЛ-4 регулирует развитие Т-хелперов (Th) в клетки Th3 и способствует стимуляции гуморального ответа (1).Сообщалось, что высокие уровни ИЛ-4 имеют решающее значение для отторжения опухолей на начальных фазах развития опухоли, и было показано, что имплантированные, сконструированные клетки, секретирующие ИЛ-4, а также вирусные векторы, трансдуцирующие ИЛ-4 опосредовать регрессию ряда злокачественных новообразований, включая меланому, глиому и карциному толстой кишки (8, 15, 19, 26). Наши результаты здесь демонстрируют, что VSV, манипулированный для экспрессии TK или IL-4, является жизнеспособным и генерирует высокие уровни гетерологичного белка после инфицирования клетки.Кроме того, оба рекомбинантных вируса, но не контрольные рекомбинантные вирусы, несущие зеленый флуоресцентный белок (GFP), проявляли более высокую онколитическую активность в исследованиях терапии опухолей, включая метастатическое заболевание, чем вирус дикого типа, и включали стимуляцию противоопухолевых специфичных цитотоксических T. -клеточные ответы. Наши данные указывают на обоснованность создания новых форм сконструированных VSV для лечения заболеваний.

МАТЕРИАЛЫ И МЕТОДЫ

Клеточные линии. Клетки меланомы

BHK-21 и B16(F10) были получены из Американской коллекции типовых культур (12) (Манассас, Вирджиния.). Клетки аденокарциномы молочной железы (TS/A) были подарены А. Ракмилевичем (20) (Университет Висконсина, Мэдисон). Клетки BHK выращивали в модифицированной основной среде Дульбекко, содержащей 10% эмбриональной бычьей сыворотки (HyClone Laboratories Inc., Логан, Юта). Клетки B16(F10) размножали в аналогичной среде, за исключением того, что она содержала опухоль молочной железы D1-DMBA3 с низкой концентрацией бикарбоната натрия (1,5 г/л). Клетки DA-3, полученные из опухоли, были любезным подарком Д. Лопеса (23) (Университет Майами, Майами, Флорида.). Первичные клетки человека (микроваскулярные эндотелиальные клетки человека [HMVECs]) были получены от Clonetics Corp. (Сан-Диего, Калифорния) и выращивались в соответствии со спецификацией производителя.

Конструирование рекомбинантных вирусов.

Вставки IL-4, TK и GFP амплифицировали из плазмид pGexp, pKO-TK и pLEGFP-C1 (Clontech Laboratories, Пало-Альто, Калифорния) соответственно с помощью ПЦР. Для IL-4 использовали праймеры 5′ GGCAC TCGAG ATGGGTCTCAACCCCCAGCTAGTTG и 5′ GCCG TCTAGA CTACGAGTAATCCATTTGCATGATGC .Для гена GFP использовали следующие праймеры: 5′-GGCA CTCGAG ATGGTGAGCAAGGGCGAGGAG и 5′-GCTTGAGC TCTAGA TCTGAGTCC CTACTTGTACAGC . Ген ТК амплифицировали с использованием следующих праймеров: 5′ CTTGTAGA CTCGAG TATGGCTTCGTACCCCGGCCATCAG и 5′ GTATTGTCT GCTAGC GTGTTT CAGTTAGCCTCCCCCATC (чужеродный ген выделен жирным шрифтом).

Продукты ПЦР IL-4 и GFP расщепляли Xho I и Xba I, тогда как продукт ПЦР TK расщепляли Xho I и Nhe I и лигировали с pVSV-XN2 (любезный подарок от John Rose, Yale University), который был переварен с Xho I и Nhe I (совместим с Xba I).Плазмида pVSV-XN2 содержит полный геном VSV и имеет уникальные сайты Xho I и Nhe I, окруженные сигналами начала и остановки транскрипции VSV. Процедура выделения инфекционного рекомбинантного VSV (rVSV) была аналогична описанной ранее (18, 22, 28).

Анализ на уничтожение клеток in vitro.

Мышиные клетки B16 и DA-3 и HMVEC высевали в 12-луночные планшеты примерно в количестве 2 × 10 5 клеток на лунку. Клетки предварительно обрабатывали IFN (человеческий альфа-2а IFN [IFN-α-2a] [Hoffman-La Roche, Nutley N.J.] для HMVEC и мышиного IFN-α/β [Sigma, Сент-Луис, Миссури] для клеток B16 и DA-3) при 1000 ЕД/мл в течение 24 часов. Затем клетки инфицировали VSV дикого типа, VSV-TK, VSV-IL-4 или VSV-GFP при множественности заражения (MOI) 0,1 в течение 18 ч, обрабатывали трипсином и подсчитывали методом исключения трипанового синего.

ИФА для продукции ИЛ-4.

Уровни IL-4 в супернатантах rVSV-IL-4, полученных через 24 часа после инфицирования клеток BHK rVSV-IL-4, определяли с использованием набора для твердофазного иммуноферментного анализа (ELISA) IL-4, полученного от Pharmingen ( Сан-Диего, Калифорния.) и следуя протоколу производителя.

ТК Ферментный анализ.

Фосфорилирование GCV использовали для измерения функциональных уровней HSV-TK в экстрактах клеток, инфицированных VSV-TK, in vitro или in vivo следующим образом (29). Для анализа in vitro клетки BHK инфицировали вирусами дикого типа или рекомбинантными вирусами в течение 8 часов. Для анализа in vivo опухолевые клетки B16(F10), инъецированные VSV дикого типа или VSV-TK, собирали через 24 часа после инокуляции вируса. Клетки BHK или B16(F10) ресуспендировали в буфере, содержащем 0.5% NP-40, 50 мМ трис-HCl (pH 7,5), 20% глицерин, 5 мМ бензамидин, 2 мМ дитиотреитол и 0,5 мМ фенилметилсульфонилфторид. Их подвергали четырем циклам замораживания-оттаивания с последующим центрифугированием лизатов при 13000×90×105 г 90×106 в течение 5 мин при 4°С. Ферментный анализ проводили с использованием 60 мкг белка в реакционной смеси, содержащей 50 мМ трис-HCl, 5 мМ хлорида магния, 5 мМ АТФ, 10 мМ фторида натрия и 2 мМ дитиотреитола, на водяной бане при 37°С. Через 0, 30 и 60 минут после добавления [ 3 H]GCV (45 мкМ) отбирали аликвоты по 20 микролитров и наносили на бумагу DE-81 (Whatman).Бумажные фильтры дважды промывали в 1 мМ формиате аммония, экстрагировали 0,1 М KCl-0,1 н. HCl и подсчитывали на сцинтилляционном счетчике.

Прививка опухоли мышам.

Самкам мышей C57BL/6 или BALB/c (в возрасте 8 недель) от Jackson Laboratories инокулировали подкожно 5 × 10 5 клеток меланомы B16(F10) (левый бок) или 1,5 × 10 6 опухоль молочной железы D1-DMBA3 клетки (молочные железы). Мышей разделили на четыре группы по пять в каждой в зависимости от типа вводимого вируса: инактивированный нагреванием VSV, VSV дикого типа, VSV-TK или VSV-IL-4.В качестве дополнительных контролей также использовали rVSV, несущий GFP. После развития пальпируемых опухолей мышам вводили 2 × 10 7 БОЕ VSV дикого типа или rVSV внутриопухолево с последующей второй инъекцией через 3 дня. Мышам, которым вводили VSV-TK, также вводили GCV (100 мг/кг массы тела) внутрибрюшинно через 1 день после первоначальной инъекции с последующими ежедневными инъекциями в течение 10 дней после этого. Опухоли измеряли три раза в неделю. Мышей умерщвляли, как только опухоли достигали величины более 1.8 см любого диаметра. Средние объемы опухолей в четырех группах сравнивали с использованием однофакторного дисперсионного анализа. Гистопатологию проводили, как описано ранее (3).

Для изучения метастатического заболевания мышам BALB/c ( n = 10 на группу) вводили через хвостовую вену 5 × 10 4 клеток TS/A. Мышей случайным образом разделили на четыре группы по 10 особей в каждой и через 4 дня сделали инъекции в хвостовую вену инактивированного нагреванием VSV, VSV-GFP, VSV-TK или VSV-IL-4 (5 × 10 6 БОЕ).Животным, которым вводили VSV-TK, также внутрибрюшинно вводили GCV (100 мг/кг). За мышами ежедневно следили после инъекции вируса, а результаты статистически анализировали с использованием теста Манна-Уитни.

Цитотоксические анализы.

Суспензию одиночных клеток селезенки культивировали в вертикальных колбах диаметром 25 мм в соотношении 20:1 с обработанными митомицином С клетками B16(F10) в течение 3 дней в присутствии 400 мкг IL-2 (Calbiochem, San Диего, Калифорния)/мл при 37°C во влажной атмосфере с 5% CO 2 .Цитотоксическую активность клеток селезенки определяли путем проведения стандартного анализа высвобождения хрома с использованием 0,1 мКи Na 2 51 CrO 4 (Amersham, Arlington Heights, IL) при 37°C в течение 2 часов. После 4-часовой инкубации эффекторных клеток и клеток-мишеней супернатанты собирали с использованием харвестера клеток SKATRON и определяли количество высвобождаемого 51 Cr с помощью гамма-счетчика (Beckman, Palo Alto, CA). Процент специфического лизиса рассчитывали по следующему уравнению для количества импульсов в минуту (имп/мин): экспериментальное высвобождение имп/мин – спонтанное высвобождение имп/мин/максимальное высвобождение имп/мин – спонтанное высвобождение имп/мин × 100.Максимальное высвобождение было числом импульсов в минуту, полученное при инкубации клеток-мишеней с 2% додецилсульфатом натрия, а спонтанное высвобождение определяли путем инкубации только с питательной средой. Спонтанное высвобождение 51 Cr всегда составляло менее 15% от общего высвобождения в этих анализах.

ОБСУЖДЕНИЕ

Здесь мы сообщаем о конструкции rVSV, несущей хорошо охарактеризованную суицидальную кассету TK или цитокин IL-4. Оба рекомбинантных вируса были изучены в противоопухолевых исследованиях и показали более высокую терапевтическую онколитическую активность, чем вирус дикого типа отдельно или контрольные вирусы, экспрессирующие GFP.Действительно, было обнаружено, что внутриопухолевые инокулированные вирусы, экспрессирующие ТК, но не ИЛ-4, стимулируют противоопухолевую цитотоксическую активность Т-клеток, которая может иметь решающее значение для устранения возникновения опухоли. Наши данные согласуются с предыдущими выводами о том, что опосредованное TK/GCV разрушение опухолевых клеток может способствовать поглощению антигена профессиональными APC (29). Возможно, процесс клеточной деструкции включает апоптоз за счет накопления р53 и активацию Fas (CD95), который затем посредством агрегации стимулирует FADD-зависимую гибель клеток независимым от лиганда Fas образом (7).Таким образом, вполне вероятно, что VSV, экспрессирующий TK, оказывает больший онколитический эффект за счет TK/GCV-опосредованного апоптоза и усиленного эффекта свидетеля, а также за счет генерации специфических противоопухолевых CTL-ответов (14, 29). Однако недавние исследования показали, что патологическая или некротическая гибель клеток, а не апоптоз, приводит к высвобождению антигенных компонентов, включая белки теплового шока, которые ответственны за активацию АПК. Таким образом, вполне возможно, что прямой вирусный лизис инфицированных клеток также может происходить в обработанной опухоли и быть главным образом ответственным за стимуляцию противоопухолевой активности ЦТЛ (6, 9).Наши результаты также согласуются с тем фактом, что, хотя ИЛ-4 может влиять на развитие Th-клеток, ИЛ-4 в этой модели опухоли не сильно влиял на развитие опухолеспецифических цитотоксических Т-клеток, судя по анализам ЦТЛ. . Тем не менее, VSV, экспрессирующий IL-4, действительно проявлял больший онколитический эффект, который был статистически значимым, чем VSV дикого типа. Хотя IL-4 был включен в ряд векторов живых вирусов либо для генной терапии, либо для противоопухолевых стратегий, либо для усиления иммунного ответа на вирусные вакцины-кандидаты, общие положительные эффекты вклада цитокина различаются (8, 19).Наши данные показывают, что опухоли, обработанные VSV, экспрессирующим IL-4, могут оказывать более сильное онколитическое действие, чем только VSV, возможно, из-за повышенного присутствия инфильтрирующих эозинофилов и нейтрофилов, которые, как сообщается, непосредственно обладают противоопухолевой активностью (26). Однако полные механизмы опосредованной IL-4 противоопухолевой активности, несомненно, еще предстоит выяснить. Наши данные также указывают на то, что системная доставка rVSV также может быть полезна в качестве терапии против метастатического заболевания. В то время как VSV-GFP, VSV-TK и VSV-IL-4 эффективно индуцируют цитолиз опухолевых клеток in vitro, включая TS/A, только вирусы, экспрессирующие TK (с GCV) или IL-4, проявляли мощную онколитическую активность in vivo.Известно, что VSV может вызывать летальность у некоторых линий мышей при введении в относительно высоких дозах (27). Однако наши данные показывают, что рекомбинантные вирусы, содержащие IL-4, TK или GFP, кажутся более аттенуированными, чем версии дикого типа (штамм Indiana) или рекомбинантные вирусы, полученные без чужеродного гена (данные не показаны). Возможно, такие изменения влияют на патогенез вируса, как изящно подчеркивают другие (5, 13, 21). Это может объяснить относительно слабый онколитический эффект VSV-GFP in vivo, подчеркивая при этом эффективные противоопухолевые эффекты, вносимые генами TK или IL-4.То, что аттенуация может быть обычным явлением во время разработки таких вирусов, может иметь преимущество при рассмотрении пригодности rVSV для лечения заболеваний человека. противовирусный клеточно-опосредованный иммунный ответ и был связан с высокой смертностью мышей, обычно устойчивых к вирусу дикого типа (16). Хотя эти данные вызывают опасения по поводу разработки новых вирусов, содержащих иммуномодулирующие гены, наши данные согласуются с исследованиями, в которых ретровирусы или аденовирусы, экспрессирующие IL-4, не вызывали побочных эффектов in vivo (10, 28).В испытаниях на безопасность мы не отметили какого-либо увеличения токсичности у животных, привитых различными путями VSV-IL-4, по сравнению с токсичностью у животных, привитых VSV дикого типа (данные не представлены). Помимо нашей неспособности обнаружить инфекционный VSV в органах или опухолях мышей, получавших лечение VSV, через 7 дней после последней инокуляции опухоли, животные, получавшие VSV-IL-4 или VSV-TK в дозе 2 × 10 7 БОЕ (внутрибрюшинно) или 2 × 10 6 БОЕ (внутривенно) в настоящее время остаются жизнеспособными через 16 недель после инфицирования.

Таким образом, наши данные показывают, что VSV можно использовать для временной экспрессии высоких уровней биологически активных рекомбинантных белков. По существу, после заражения вирусом предотвращается клеточная транскрипция и трансляция, а цитоплазматические ресурсы направляются на безудержную экспрессию вирусных генов и любых сопутствующих чужеродных кассет, даже потенциально токсичных клеточных или вирусных генов. Таким образом, мы демонстрируем, что, помимо прямого проявления онколитической активности, опосредованной вирусом, VSV может быть модифицирован для доставки ключевых генов, таких как суицидные и иммуномодулирующие кассеты, которые могут значительно увеличить уничтожение опухоли.Кроме того, VSV обладает высокой специфичностью к мишеням и высокой эффективностью трансфекции. Таким образом, создание новых сконструированных VSV, способных эффективно транспортировать и экспрессировать гены, способные стимулировать опосредованные хозяином иммунные ответы, которые считаются критически важными для искоренения присутствия опухоли, а также для защиты от дальнейшего развития опухоли, можно считать действенной терапевтической стратегией.

Лечение стоматита при использовании эверолимуса для НЭО

Cecilia Lau, RPh, BCOP, APh: Лечение стоматита или профилактика стоматита не изучались у пациентов с нейроэндокринными опухолями, но есть данные, полученные от наших коллег по раку молочной железы. .

Было исследование фазы 2 под названием SWISH, в котором пациентам, впервые начавшим лечение эверолимусом в сочетании с экземестаном, в течение первых 8 недель назначали полоскание рта дексаметазоном. В исследовании не было контрольной группы, поэтому исследователи использовали исторический контроль из исследования BOLERO-2. К концу 8-й недели стоматит 2-й степени или выше в исследовании SWISH составлял всего 2% по сравнению с историческим контролем исследования BOLERO-2, в котором к концу 8-й недели стоматит возник у 30%. В исследовании SWISH пациентам разрешалось продолжать полоскание рта дексаметазоном в течение еще 8 недель, если это необходимо, и неясно, могут ли пациенты продолжать лечение даже после 16 недель, поскольку этот препарат легко доступен, недорог и покрывается большинством страховых компаний. страхование.

Мы, фармацевты, должны знать, что жидкий дексаметазон доступен в виде раствора для приема внутрь и эликсира для приема внутрь в одинаковой концентрации. Когда мы отпускаем, мы должны быть уверены, что мы отпускаем раствор для перорального применения, не содержащий спирта. Доза составляет 1 мг или 10 мл, и пациент должен быть проинструктирован полоскать рот 10 мл в течение 2 минут, после чего он выплюнет раствор. Они должны делать это 4 раза в день.

Даненг Ли, MD: Это так важно.Для пациентов, когда вы меняете лечение, обычно роль эверолимуса добавляется после того, как кто-то проходил другие виды лечения, такие как терапия аналогами соматостатина, так что может быть много беспокойства с точки зрения понимания эффективности, а также безопасности и побочных эффектов. -эффектный профиль. Если у вас есть возможность иногда общаться, я ценю всех наших фармацевтов и коллег, которые получат много вопросов от пациентов, которым поставщик может прописывать это лекарство.Но если вы сможете провести их через неблагоприятные последствия, с которыми они могут столкнуться, это поможет успокоить их разум. Это один из вариантов лечения, которые у нас есть для этого заболевания, поэтому мы должны использовать все возможные методы лечения для этих пациентов.

Везикулярный стоматит: что нужно знать об экспорте в США и импорте в Канаду

Везикулярный стоматит не вызывает беспокойства в Канаде с 1949 года, однако недавно было подтверждено несколько случаев заболевания в США.S., и поскольку многие наши клиенты собираются на концерты в США, мы хотели поделиться этой новостью. Делясь этой новостью, мы надеемся предотвратить везикулярный стоматит в Канаде и помочь животным, пересекающим границу, вернуться домой в Канаду здоровыми и счастливыми.

Везикулярный стоматит — это вирусное заболевание, поражающее преимущественно лошадей, крупный рогатый скот и свиней. Хотя везикулярный стоматит вызывает дискомфорт у больных животных и может привести к потере рынков сбыта живых животных, мяса и генетики животных, он наиболее важен, поскольку очень напоминает ящур.Ящур поражает жвачных животных и свиней и является разрушительным заболеванием для производителей.

Животные заражаются вирусом везикулярного стоматита при употреблении в пищу или при контакте с веществами, загрязненными слюной или жидкостью из поражений инфицированных животных. Распространение в молочных стадах также может происходить в результате процедур доения. В некоторых регионах значительную роль в распространении болезни играют насекомые. Болезнь также может передаваться человеку при контакте с инфицированными животными.Он вызывает гриппоподобные симптомы.

Везикулярный стоматит вызывает легкую лихорадку и образование волдырей на внутренней стороне рта, а также на губах, носу, копытах и ​​вымени. Волдыри лопаются, оставляя воспаленные участки. У больных животных часто наблюдается обильное слюноотделение, они не хотят есть или пить. Некоторые животные, особенно свиньи, могут хромать. У дойных коров наблюдается заметное снижение молочной продуктивности. Инкубационный период (время между заражением вирусом и появлением клинических признаков) может составлять от двух до восьми дней, и животные обычно полностью выздоравливают через три-четыре дня.

Если у вашего животного проявляются какие-либо из перечисленных выше клинических признаков:

  • Немедленно позвоните своему ветеринару или позвоните в ближайший офис Канадского агентства по надзору за продуктами питания (CFIA), который указан на синих страницах вашего телефонного справочника. Везикулярный стоматит является заболеванием, подлежащим регистрации в соответствии с Законом о здоровье животных . Это означает, что обо всех подозрительных случаях необходимо сообщать в CFIA.

  • Животные с поражениями должны содержаться отдельно от здоровых животных, предпочтительно в помещении.НЕ выводите животных из вашего помещения, пока не будет поставлен окончательный диагноз.

  • Носите защитную одежду при работе с подозрительными животными, чтобы предотвратить контакт с вирусом.

Экспериментально разработаны вакцины для борьбы с везикулярным стоматитом, но в настоящее время ни одна из них не одобрена для использования у лошадей. Ведутся серьезные споры об эффективности вакцинации в предотвращении или снижении тяжести вспышки. Считается, что период защиты довольно ограничен, и после вакцинации животные будут давать положительный результат в течение длительного периода времени, что приведет к ограничениям на поездки.

В связи с недавней вспышкой везикулярного стоматита в Соединенных Штатах мы в Центральной ветеринарной службе получили уведомление о том, что Министерство сельского хозяйства США (Министерство сельского хозяйства США) попросили немедленно приостановить выдачу или подтверждение экспортных сертификатов на лошадей, свиней и жвачные животные из Оклахомы, Вайоминга, Коларадо, Нью-Мексико и Техаса.

Министерство сельского хозяйства США также попросили предоставить копии любых справок о состоянии здоровья этих животных из затронутых округов в перечисленных выше штатах, выданных для Канады за 30 дней до вспышки.

Ввоз лошадей, свиней и жвачных животных из вышеуказанных штатов для всех видов конечного использования в Канаду будет запрещен с немедленным вступлением в силу. Чтобы принять это решение, CFIA рассмотрит все штаты, в которых животное (животные) проживали за последние 21 день, чтобы убедиться, что в штате отсутствуют клинические и эпидемиологические признаки везикулярного стоматита в течение 21 дня, непосредственно предшествующего экспорту в Канаду.

«Исключение: Лошади, свиньи и жвачные животные из нового пораженного ВС штата, которые сопровождаются действительным сертификатом U.S. свидетельство о состоянии здоровья и прибытие в порт въезда в Канаду в течение трех (3) дней с даты уведомления разрешается въезд; зависит от результатов детальной инспекции, описанной ниже. По истечении этого периода ввоз всех восприимчивых видов будет запрещен. Это исключение также распространяется на канадских животных, возвращающихся по действительному экспортному сертификату CFIA. Любые медицинские сертификаты США, подтвержденные или после даты уведомления , не считаются действительными.

Ветеринар CFIA в порту въезда должен провести клиническое обследование животных с дополнительным рассмотрением везикулярного стоматита и определить, следует ли им разрешить въезд в Канаду.

подробный осмотр  включает, но не ограничивается:

1. Осмотр полости рта (как щечной, так и язычной), включая язык на наличие везикулярных образований. Для таких обследований пригодится фонарик.
2. По возможности проверьте наличие хромоты, осмотрев ступни на наличие везикул;
3.осмотрите вымя или крайнюю плоть;
4. Проверьте температуру животного

Что особенно важно для наших клиентов и их животных, канадские лошади, свиньи и жвачные животные, возвращающиеся в Канаду, не смогут въехать в Канаду после пребывания в вышеуказанных штатах США в течение последних 21 дня. Они должны быть перемещены в незараженный штат США, оставаться там не менее 21 дня и получить следующие сертификаты Министерства сельского хозяйства США:

«Все штаты, в которых животное (животные) проживали в течение последних двадцати одного (21) дня, должны быть свободны от клинических и эпидемиологических признаков везикулярного стоматита в течение двадцати одного (21) дня, непосредственно предшествующего экспорту в Канада.

ПРИМЕЧАНИЕ: Некоторые штаты США также могут запрещать въезд в штат без разрешения/сертификации/тестирования/тестирования после въезда. Владелец канадской лошади/свиньи/жвачного животного должен перед перемещением ознакомиться с требованиями штата.

  ИСТОЧНИКИ:  
  https://www.inspection.gc.ca/animals/terrestrial-animals/diseases/reportable/vesicular-stomatitis/fact-sheet/eng/1306640102681/1306848592941  
  https://www.aphis.usda.gov/aphis/ourfocus/animalhealth/animal-disease-information/cattle-disease-information/vesicular-stomatitis-info  

Walter’s Wish — Oregon Humane Society

Обновление: Уолтера усыновили всего через несколько дней после того, как его история была опубликована в социальных сетях.
Наши усыновители — настоящие герои.

Энни специально хотела взять кошку, которой было трудно найти дом. Когда Энни пришла 20 февраля, они сидели с Уолтером спокойно и тихо, просто позволяя ему быть, мягко гладя его по голове и мягко заверяя его, что лучшие дни еще впереди. «У меня есть очень красивое окно, за которым можно сидеть и смотреть».

Когда оформление документов было завершено, Энни разволновалась. «Давай отвезем тебя домой, пока я не заплакал»

Узнайте больше о путешествии Уолтера в дом навсегда ниже.

_____________________________

Как потерянный кот получил лечение, в котором нуждался от мучительной болезни
В одиночестве, страдая от боли и блуждая по улицам Ла-Гранд, бедный Уолтер нуждался в чуде. Удача повернулась к нему, когда в сентябре о нем начал заботиться добрый самаритянин. Поездка к ветеринару открыла ужасные новости. Уолтер страдал от болезненного стоматологического заболевания, называемого стоматитом. Это состояние трудно поддается лечению и требует повторных и часто дорогостоящих стоматологических процедур.Итак, в январе Уолтер оказался в Blue Mountain Humane в ЛаГранде. Добрый самаритянин, который заботился о нем, больше не мог позволить себе его тяжелое состояние здоровья.

Программа второго шанса OHS часто сотрудничает с Blue Mountain Humane, поэтому, когда поступил звонок о помощи, медицинская бригада OHS рассмотрела случай Уолтера, и его должны были доставить в Портленд.

Когда Уолтер приехал, было ясно, что у него стоматит в тяжелой форме. Ему уже удалили 17 зубов, и было решено, что единственный способ облегчить его боль — удалить оставшиеся 13 зубов.Его выздоровление было трудным, но после нескольких дней любви и заботы в Медицинском центре OHS он начал поправляться. Команда уговаривала его поесть и предоставляла ему специальные условия, чтобы он чувствовал себя комфортно. Затем он провел несколько недель в приемной семье, пока его рот продолжал заживать после операции на полости рта.

Теперь Уолтер ждет своего следующего счастливого случая. Со всеми операциями позади, теперь он готов к следующей счастливой и здоровой главе своей жизни. Ваш любящий дом, которого он ждет?

ОБНОВЛЕНИЕ: У ВАЛЬТЕРА ЗАПЛАНИРОВАН ПРИЕМ НА УСЫНОВЛЕНИЕ

У вас есть вопросы о стоматите? Др.Стив Кочис, главный врач OHS, отвечает на часто задаваемые вопросы о болезни ниже:

Что такое стоматит?

Стоматит — болезненное хроническое заболевание, вызывающее сильное воспаление тканей полости рта, в результате чего десны, края губ, мягкое небо и задняя часть ротовой полости приобретают ярко-красный, раздраженный вид. Ткань становится более нежной и легко кровоточит. Кошки могут быть скрытными и хорошо скрывать от нас вещи, но эти кошки часто испытывают трудности с едой, могут терять вес, тереться лапой о рот или чрезмерно пускать слюни.Они могут казаться более неопрятными, чем обычно, что может произойти из-за плохого питания и недостаточного ухода за собой

Стоматит поражает только кошек или собак тоже?

Стоматит может поражать кошек и собак. Однако у собак это, по-видимому, ограничено определенными породами.

Как у кошек возникает стоматит?

Хотя стоматит довольно распространен, причина его остается в основном неизвестной. Считается, что это состояние вызвано чрезмерной реакцией иммунной системы кошки на нормальные бактерии зубного налета, что приводит к тяжелой воспалительной реакции.Состояние также может ухудшиться, если присутствуют другие формы стоматологических заболеваний. Дополнительные тесты могут быть выполнены, чтобы увидеть, есть ли какие-либо другие сопутствующие заболевания или сопутствующие факторы. В случае Уолтера он дал отрицательный результат на FeLV/FIV.

Что такое лечение?

Специального лечения стоматита не существует. Поскольку это воспаление часто вызывается чрезмерной реакцией на бактерии зубного налета на зубах, распространенным способом лечения этого состояния является удаление всех (или почти всех) зубов кошки.В настоящее время это единственное решение, которое обеспечивает долгосрочное облегчение боли и воспаления. Было показано, что удаление зубов устраняет стоматит у большинства кошек, но некоторым все же может потребоваться долгосрочная медицинская помощь, если воспаление не проходит. Медикаментозное лечение часто состоит из противовоспалительных препаратов, антибиотиков и ежедневной чистки полости рта.

Нужно ли кормить кошек со стоматитом специальной диетой?

Поскольку кошкам с крайними случаями стоматита, таким как Уолтер, удалили все зубы, рекомендуется диета из мягкой пищи.

Что еще должен знать потенциальный усыновитель о приеме животного со стоматитом?

У домашних животных со стоматитом могут быть другие сопутствующие проблемы с иммунитетом, поэтому владельцы должны быть в курсе любых изменений в состоянии здоровья своего питомца или новых симптомов. Даже у питомца без зубов десны все равно могут воспалиться, и его следует контролировать и лечить по мере необходимости.

 

Ваш подарок спасает жизни. Пожалуйста, дайте сегодня и помогите питомцу в беде.

Онколиз вируса везикулярного стоматита потенцируется нарушением mTORC1-зависимой продукции IFN I типа

Abstract

Онколитические вирусы представляют собой многообещающую терапию против злокачественных глиом (МГ).Однако вирус-индуцированный IFN типа I сильно ограничивает его клиническое применение. Киназа-мишень рапамицина у млекопитающих (mTOR) стимулирует продукцию IFN I типа посредством фосфорилирования его эффекторных белков, 4E-BP и S6K. Здесь мы показываем, что мышиные эмбриональные фибробласты и мыши, лишенные S6K1 и S6K2, более восприимчивы к инфекции вирусом везикулярного стоматита (VSV), чем их аналоги WT, в результате нарушенного ответа IFN I типа. Мы использовали эти знания для применения фармаковирусного подхода к лечению миастении.Высокоспецифический ингибитор mTOR рапамицин в сочетании с IFN-чувствительным мутантным штаммом VSV (VSV ΔM51 ) резко увеличивал выживаемость иммунокомпетентных крыс, несущих MG. Что еще более важно, VSV ΔM51 избирательно убивал опухоль, но не нормальные клетки, у несущих MG крыс, получавших рапамицин. Эти результаты демонстрируют, что снижение уровня IFN I типа путем ингибирования mTORC1 является эффективной стратегией усиления терапевтической активности VSV ΔM51 .

Злокачественные глиомы (МГ) на сегодняшний день являются наиболее частыми, агрессивными и летальными вариантами первичной опухоли головного мозга (1, 2). Медиана выживаемости пациентов с миастенией составляет приблизительно 1 год, и они плохо реагируют на большинство доступных терапевтических методов (3). ⇓–5). Таким образом, необходимы более эффективные методы лечения.

Недавние данные свидетельствуют о том, что сигнальный путь PI3K/мишень рапамицина (mTOR) у млекопитающих является одним из основных онкогенных сигнальных путей, нарушение регуляции которого может лежать в основе глиомагенеза (6, 7).mTOR существует в виде двух комплексов: комплекса mTOR 1 (mTORC1), который чувствителен к лекарственному средству рапамицину и регулирует трансляцию мРНК, и mTORC2, который нечувствителен к рапамицину и регулирует организацию актинового цитоскелета (обзор в ссылках 8). ⇓–10). mTORC1 стимулирует продукцию IFN I типа посредством фосфорилирования белков-мишеней 4E-BP и S6K1/2 (11). Доказательства критической роли сигнального пути mTORC1 во врожденном иммунитете появились на основании того, что ингибитор mTORC1 рапамицин подавляет IFN типа I в плазмоцитоидных дендритных клетках (pDCs), которые являются основными производителями системного IFN типа I (12).Кроме того, генетическая делеция нижестоящей мишени mTOR S6K1/2 приводит к нарушению ответа IFN I типа (см. Results ). Напротив, мы недавно обнаружили, что отсутствие репрессоров трансляции 4E-BP1/2 приводит к усиленной продукции IFN I типа (13).

Онкогенная трансформация связана с недостаточным ответом IFN I типа, который представляет собой первую линию защиты от вирусной инфекции (14, 15). Онколитические вирусы изучаются как эффективные противораковые агенты, поскольку они используют этот избирательный дефект (16). ⇓ ⇓–19).Одним из наиболее хорошо охарактеризованных онколитических вирусов, репликация которого чрезвычайно чувствительна к ингибированию IFN, является вирус везикулярного стоматита (VSV) (20). Однако есть несколько причин, ограничивающих использование онколитических вирусов для лечения МГ. Во-первых, некоторые MG демонстрируют устойчивый ответ IFN типа I, который может предотвратить онколиз вируса in vivo и in vitro. Во-вторых, онколитические вирусы являются внеклеточными патогенами, поэтому иммунная система препятствует их репликации и распространению даже внутри опухоли.Наконец, MG очень гетерогенны, что способствует их терапевтической резистентности. Как следствие, MG, как правило, избегают однонаправленных терапевтических подходов, предназначенных для подавления пролиферации и выживания MG (4). Таким образом, комбинаторный подход, который подавляет выживание опухолевых клеток и в то же время избирательно способствует репликации вируса в злокачественных клетках, должен привести к более эффективному лечению опухолей и, в конечном итоге, ускорить их перенос из лаборатории в клинику. Таким образом, мы разработали «фармаковирусный» подход к лечению МГ.Здесь мы демонстрируем, что комбинация рапамицина, который специфически подавляет активность mTORC1, с VSV ΔM51 значительно продлевает выживаемость иммунокомпетентных крыс, несущих злокачественные глиомы. Кроме того, мы определяем точный молекулярный механизм, лежащий в основе этого процесса.

Результаты

Клетки злокачественной глиомы реагируют на интерферон типа I и продуцируют его.

Хотя VSV обычно реплицируется в клеточных линиях глиомы человека (21), считается, что MG вызывают IFN-ответ типа I (16, 22), которого может быть достаточно, чтобы препятствовать внутриопухолевому распространению вируса.Действительно, при предварительной обработке человеческим IFN-β как клеточные линии глиомы человека, так и свежеиссеченные клетки глиомы защищаются от VSV ΔM51 (чрезвычайно чувствительный к IFN мутантный штамм VSV и прототип онколитической терапии на основе VSV; рис. 1 ). A и B и рис. S1). Кроме того, свежеиссеченные клетки глиомы и клеточные линии глиомы человека и крысы продуцируют ИФН I типа, что определяется с помощью анализов защиты от VSV и анализа ИФН I типа HEK-Blue (InvivoGen; рис. 1 C E ).Важно отметить, что образование IFN типа I предотвращалось, когда клеточные линии глиомы предварительно обрабатывали рапамицином (рис. 1 F ). Эти данные показывают, что ингибирование mTORC1 блокирует продукцию IFN I типа in vitro.

Рисунок 1. Клеточные линии

глиомы реагируют на интерферон I типа и продуцируют его. ( A ) Добавление IFN-β защищает клетки глиомы от инфекции VSV. Линии клеток глиомы человека U87, U251 и U118 предварительно обрабатывали возрастающими количествами человеческого IFN-β в течение 6 ч перед инфицированием VSV ΔM51 -GFP (MOI 1).Через 24 ч после заражения флуоресценцию GFP и ЦПЭ анализировали с помощью фазово-контрастной и флуоресцентной микроскопии. ( B ) Свежеиссеченные клетки глиомы обрабатывали, как описано, и инфицировали VSV ΔM51 -RFP (MOI 10). ( C ) Poly(I:C) стимулирует IFN типа I в клетках RG2, а кондиционированная среда защищает клетки от инфекции VSV. Схема анализа: клетки RG2 трансфицировали поли(I:C) дцРНК (1 мкг/мл) в течение 6 часов. Культивируемую среду использовали для обработки либо RG2, либо крысиных астроцитов за 12 ч до инфицирования VSV ΔM51 -RFP (MOI 1).Флуоресценцию RFP и CPE анализировали, как описано. ( D ) Обнаружение продукции IFN I типа. Фибробласты крайней плоти человека и указанные линии клеток глиомы человека обрабатывали поли(I:C) (1 мкг/мл) в течение 24 часов. Собирали супернатант и использовали 30 мкл для кондиционирования клеток IFN HEK-Blue типа I (InvivoGen). ОП измеряли колориметрическим методом при 650 нм с использованием реагента Quanti-Blue (InvivoGen). Продукцию IFN наносили на график в относительных единицах IFN. ( E ) Свежеиссеченные клетки глиомы обрабатывали поли(I:C) (1 мкг/мл) в течение 24 часов и оценивали продукцию IFN типа I, как в D .( F ) Рапамицин снижает ответ IFN типа I в клетках глиомы. Линии клеток глиомы человека U251 и U343 предварительно обрабатывали ДМСО или рапамицином (20 нМ) в течение 1 ч перед стимуляцией поли(I:C) в концентрации 1 мкг/мл, а через 6 ч после поли(I:C) проводили колориметрический анализ IFN HEK-Blue типа I. I:C) стимуляция.

Рапамицин потенцирует VSV-онколиз глиом in vivo.

В свете этих результатов мы пришли к выводу, что блокирование активности mTORC1 in vivo с помощью рапамицина будет подавлять системную продукцию IFN I типа и обеспечивать репликацию VSV ΔM51 в IFN-продуцирующей MG.Чтобы проверить эту гипотезу, мы использовали фармаковирусный подход, при котором мы объединили рапамицин с VSV ΔM51 на модели иммунокомпетентной глиомы крысы RG2 (23, 24). Дизайн экспериментов in vivo был основан на нашей предыдущей работе с использованием этой иммунокомпетентной крысиной модели MG (23, 25). Вкратце, крысам интракраниально вводили клетки RG2, а затем внутрибрюшинно обрабатывали либо носителем, либо рапамицином в течение 10 дней. Через один день после инъекции рапамицина внутривенно вводили VSV ΔM51 при множественности инфицирования (MOI) 5 × 10 8 БОЕ.Чтобы определить, блокирует ли рапамицин системную продукцию IFN типа I, которая индуцируется VSV ΔM51 in vivo, сыворотку собирали через 2 дня после инфицирования VSV ΔM51 , а серийно разведенные аликвоты добавляли к клеткам RG2 до их инфицирования VSV ΔM51. при МВД 0,1. Поразительно, что сыворотка животных, получавших рапамицин, была менее мощной (в 25 раз) в защите клеток RG2 от инфекции VSV ΔM51 , чем сыворотка животных, не получавших лечения, что определялось флуоресценцией VSV ΔM51 -RFP и цитопатическим эффектом (CPE) (рис.2 А ). Напротив, нетрансформированные крысиные астроциты и клетки фибробластов (Rat1) требовали гораздо более низких (в 5–10 раз) концентраций в сыворотке животных, получавших рапамицин, для защиты от VSV ΔM51 (рис. S2). Эти данные демонстрируют, что опосредованное mTORC1 снижение продукции IFN I типа защищает нормальные, но не клетки глиомы, от онколиза, опосредованного VSV ΔM51 . В соответствии с данными in vitro, VSV ΔM51 -GFP был обнаружен в глиомах (но не в нормальной ткани головного мозга) у животных, получавших рапамицин, через 3 дня после инъекции, как определено с помощью флуоресценции GFP и иммуногистохимии (рис.2 В ; для количественной оценки см. рис. S3). Комбинация рапамицин-VSV ΔM51 значительно увеличивала выживаемость иммунокомпетентных крыс, несущих MG, и вызывала уменьшение размера опухоли (рис. 2 D и E и рис. S3). Кроме того, у несущих MG крыс, получавших рапамицин, вирус реплицировался исключительно в опухоли, а не в нормальных клетках, что было определено с помощью количественной ПЦР в реальном времени (рис. S3 D ). ). Примечательно, что вирус сам по себе не смог улучшить выживаемость, что указывает на то, что опухоль действительно является IFN-компетентной (рис.2 E ). Эти данные демонстрируют, что mTORC1-опосредованное снижение системного IFN I типа in vivo повышает чувствительность клеток глиомы, но не нормальных клеток, к вирус-опосредованному онколизу.

Рис 2.

Рапамицин усиливает онколиз VSV ΔM51 за счет снижения продукции IFN I типа. Рапамицин снижает уровень противовирусных цитокинов, образующихся при инфицировании VSV ΔM51 . ( A ) Крыс лечили или не лечили рапамицином (5 мг/кг) за 1 день до и каждый день после i.v. заражение VSV ΔM51 -GFP (MOI 5 × 10 8 БОЕ на крысу). Через 48 ч после заражения собирали сыворотку и добавляли различные разведения к клеткам RG2 за 1 ч до инфицирования VSV ΔM51 -RFP (MOI 0,1). Через 20 ч после заражения оценивали флуоресценцию РФП и ЦПД, как на рис. 1А. Жизнеспособность оставшихся клеток дополнительно подтверждали анализом МТТ. ( B ) Наличие VSV в опухолях глиомы. Флуоресценция GFP и иммуногистохимия белков VSV на срезах головного мозга крыс, инфицированных VSV ΔM51 -GFP (72 ч после заражения), предварительно обработанных или не обработанных рапамицином.Комбинация VSV ΔM51 и рапамицина продлевает выживаемость и снижает рост опухоли крысиной модели злокачественной глиомы. ( C ) Окрашивание H&E опухолей RG2 при различных состояниях на 13 день после внутричерепной инъекции RG2. ( D ) В день 0 крысам внутричерепно имплантировали клетки крысиной глиомы RG2, экспрессирующие люциферазу (RG2-Luc; 1×10 4 клеток). В день 6 рапамицин (5 мг/кг) вводили внутрибрюшинно. инъекции в течение 10 дней. Контрольные крысы получали только носитель.В день 7 внутривенно вводили раствор VSV ΔM51 -GFP или PBS. инъекция (МВД 5 × 10 8 БОЕ). Фотография, показывающая экспрессию люциферазы в опухолях RG2-Luc на 13, 17 и 21 день у репрезентативных крыс каждой группы. ( E ) Кривая выживания Каплана-Мейера. Средняя выживаемость в контроле 15,6 дня; VSV ΔM51 -GFP, 16,4 д; рапамицин, 22 дня; VSV ΔM51 -GFP + рапамицин, 39,8 д. Контроль и VSV ΔM51 — лог-ранговый тест GFP, P = 0.2402; контроль и лог-ранговый тест рапамицина, P = 0,0038; контроль и VSV ΔM51 -GFP плюс лог-ранговый тест рапамицина, P = 0,0007; рапамицин и VSV ΔM51 -GFP плюс лог-ранговый тест рапамицина, P = 0,0011.

Врожденный противовирусный ответ нарушен у мышей и клеток, лишенных S6K1 и 2.

Как mTORC1 контролирует продукцию IFN I типа и онколиз, опосредованный VSV? 4E-BP негативно регулируют продукцию IFN I типа (13).Кроме того, pDCs, лишенные нижележащих мишеней mTORC1, S6K1 и S6K2, не способны генерировать IFN типа I в ответ на стимуляцию Toll-подобных рецепторов (12). Поэтому было уместно изучить роль S6K в репликации вируса. С этой целью мы использовали эмбриональные фибробласты мыши (MEF) и мышей с дефицитом S6K1/2 (S6K1/2 DKO) (26). MEF инфицировали при множественности заражения 10 pfu на клетку, и синтез белка VSV определяли в разное время после инфицирования с помощью импульсного мечения [ 35 S]метионином (13, 27).Белки VSV были впервые обнаружены через 6 часов после заражения в MEF S6K1/2 DKO (рис. 3 A и B ), тогда как в MEF WT белки VSV были слабо обнаружены вестерн-блоттингом через 8 часов после заражения (рис. 3 B ), что указывает на то, что S6K положительно контролируют распространение VSV. В соответствии с опубликованными отчетами (28, 29), в ранние сроки после инфицирования MEF WT были удивительно устойчивы к небольшим количествам VSV (MOI 1), что может быть результатом генетического фона MEF (30).Однако при более высоких MOI (рис. S4 A ) или позднее время после заражения (рис. S4 B ), белки VSV четко наблюдались в MEF WT; тем не менее, кинетика репликации VSV была постоянно выше в MEF S6K1/2 DKO (рис. S4 B ). ). Важно отметить, что введение S6K1 и S6K2 в S6K1/2 DKO MEF спасло восприимчивость клеток к инфекции VSV (рис. S5), демонстрируя, что VSV-чувствительный фенотип S6K1/2 DKO MEF вызван отсутствием S6K1/2. .VSV-индуцированный CPE через 12 часов после инфицирования был более выражен в MEF S6K1/2 DKO (рис. 3 C ), поскольку они генерировали более чем в 100 раз больше инфекционных вирусных частиц, чем контрольные MEF дикого типа (рис. 3 D ). . В соответствии с этими данными индуцированная вирусом продукция IFN типа I была нарушена в сыворотке мышей S6K1/2 DKO in vivo (фиг. 3 E ), как определено с помощью ELISA. Следовательно, 40% мышей S6K1/2 DKO умерли от инфекции VSV, тогда как все мыши WT выжили (рис. 3 F ).Кроме того, выход VSV был значительно увеличен (примерно в 10 раз) в легких мышей S6K1/2 DKO по сравнению с мышами дикого типа (фиг. 3 F ).

Рис. 3.

MEF и мыши, лишенные S6K1/2, чувствительны к инфекции VSV. MEF WT и S6K1 / 2 DKO были инфицированы VSV (MOI 10), и вирусная инфекция наблюдалась в течение 10 часов после заражения. ( A ) MEF инкубировали с [ 35 S] метионином в течение 1 часа в указанные моменты времени после заражения. Белки подвергали SDS-PAGE и переносили на мембрану.Показана авторадиограмма. Вирусные белки указаны справа. G , гликопротеин; M , белок матрикса; N/P , нуклеокапсидный белок/фосфопротеин. Инфекция была также подтверждена вестерн-блоттингом с использованием антител против белков VSV, S6K1, S6K2 и β-актина ( B ), индуцированного VSV CPE через 12 часов после заражения ( C ) и титров вируса, определенных методом анализа бляшек. через 30 ч после заражения при множественности множественности 1 ( D ) (среднее значение ± стандартное отклонение трех независимых экспериментов).( E ) Мышей WT и S6K1/2 DKO ( n = 3 на группу) инфицировали вирусом VSV (1 × 10 8 БОЕ), и сыворотку собирали через 48 часов после инфицирования. Уровни IFN-β измеряли с помощью ELISA. ( F ) Выживаемость WT и S6K1/2 DKO, инфицированных VSV. Мышей ( n = 10) интраназально инфицировали ВВС (1×10 8 БОЕ), и их выживаемость изображали в виде кривой Каплана-Мейера. Показаны вирусные титры, обнаруженные в тканях легких через 3 дня после инфицирования.

Чтобы определить, проявляют ли MEF S6K1/2 DKO нарушенный ответ IFN I типа, MEF WT и S6K1/2 DKO трансфицировали поли(I:C), мощным индуктором IFN I типа (рис.4). Продукция IFN типа I определялась путем измерения ингибирования репликации вируса, индуцированного VSV CPE и ELISA (13). В соответствии с повышенной восприимчивостью мышей S6K1/2 DKO к инфекции VSV, MEF S6K1/2 DKO не защищали клетки от инфекции VSV и продуцировали меньше IFN I типа по сравнению с MEF дикого типа (рис. 4 A E ). Затем мы спросили, можно ли восстановить восприимчивый к VSV фенотип у MEF S6K1/2 DKO путем добавления экзогенного IFN I типа. WT и S6K1/2 DKO MEF были примированы увеличивающимися количествами экзогенного IFN типа I (IFN-α/β) и впоследствии инфицированы VSV-GFP.Для защиты MEF S6K1/2 DKO от инфекции VSV-GFP требовалось в десять раз больше экзогенного IFN I типа по сравнению с MEF WT (рис. 4 F и G ). Кроме того, экспрессия гена IFN I типа была недостаточной в MEF, лишенных S6K1 и S6K2, что было определено с помощью анализа репортерного промотора IFN и преимущественной репликации штамма VSV, гиперчувствительного к IFN (VSV ΔM51 ) в этих клетках (рис. S6). . В совокупности эти данные демонстрируют, что продукция IFN типа I нарушена у MEF и мышей, лишенных S6K1/2.

Рис. 4.

MEF, лишенные S6K1/2, имеют нарушенный ответ IFN I типа. ( A ) Схема эксперимента по анализу защиты: МЭФ дикого типа и S6K1/2 DKO подвергали имитационной обработке или обработке 1 мкг/мл синтетической дцРНК поли(I:C) в течение 6 часов. Затем собирали супернатанты клеток и помещали на ночь на клетки WT. На следующий день клетки WT инфицировали VSV при множественности инфекций 1 в течение 36 часов. Вирусные инфекции оценивали по цитопатическим эффектам ( B ), титрам вируса, определяемым с помощью анализа бляшек ( C ), остаточной жизнеспособности, определяемой с помощью анализа МТТ ( D ), и продукции IFN-α, определяемой с помощью ELISA ( E ).(Планки погрешностей соответствуют среднему значению ± стандартное отклонение экспериментов, проведенных в трех повторностях.) Нарушение ответа на экзогенный IFN типа I у MEF S6K1/2 DKO. MEF WT и S6K1 / 2 DKO обрабатывали мышиным IFN-α / β в течение 6 часов с последующим инфицированием VSV-GFP (MOI 1). Инфекцию контролировали через 36 ч после инфицирования с помощью анализа МТТ ( F ) и флуоресценции GFP и CPE ( G ).

Чтобы исследовать молекулярные механизмы, с помощью которых S6K1/2 регулирует продукцию IFN I типа, мы изучили роль регуляторного фактора IFN-7 (IRF-7), который необходим для индуцированной вирусом продукции IFN I типа (31).Экспрессия конститутивно активного белка IRF-7 защищала MEF как WT, так и S6K1/2 DKO от инфекции VSV (рис. S7). Однако WT IRF-7 не смог защитить MEF S6K1/DKO от VSV по сравнению с MEF WT. Эти данные свидетельствуют о том, что активация (то есть фосфорилирование) IRF-7 с помощью S6K1/2 является решающим этапом противовирусного ответа. Эти результаты согласуются с недавно опубликованными Cao et al. (12), которые показывают, что рапамицин предотвращает фосфорилирование IRF-7 в pDC.

Обсуждение

Считается, что онколитические вирусы размножаются и убивают многие типы злокачественных клеток in vitro и in vivo в результате нарушения ответа IFN I типа в раковых клетках (16, 18).Однако в дополнение к тому факту, что многие раковые клетки продуцируют интерферон типа I (16, 32), индуцированный вирусом «системный» ответ на интерферон типа I также препятствует использованию онколитических вирусов, таких как VSV ΔM51 , в качестве эффективных терапевтических агентов. Таким образом, эффективность онколитического терапевтического действия VSV ΔM51 определяется сочетанием двух основных факторов: ( и ) дефицита ИФН I типа и ( ii ) опухолеспецифической репликации вируса. Здесь мы сообщаем о методе, преодолевающем эти препятствия, который сочетает в себе лекарство (рапамицин) с онколитическим вирусом VSV ΔM51 для лечения MG.На молекулярном уровне мы продемонстрировали, что mTORC1 через свои нижележащие мишени 4E-BP и S6K регулирует продукцию IFN I типа и размножение вируса (13) (рис. 3 и 4 и рис. S4–S7). Рапамицин блокирует опосредованное mTORC1 фосфорилирование 4E-BP и S6K1/2, тем самым предотвращая трансляцию и активацию IRF-7 (12, 13). В соответствии с этими данными рапамицин блокирует системный IFN I типа и противовирусные цитокины (рис. 2), скорее всего, за счет ингибирования активности mTORC1 в pDC (12). Снижение количества циркулирующего системного IFN I типа и противовирусных цитокинов защищает нормальные, но не MG клетки, от вирусной инфекции.Следовательно, комбинация рапамицина и VSV ΔM51 не только продлевает выживаемость, но и значительно уменьшает размер опухоли у крыс, несущих MG (рис. 2). Хотя рапамицин в сочетании с другими вирусами (например, вирусом миксомы, вирусом коровьей оспы или аденовирусом) усиливает онколиз (23, 33 ⇓ ⇓–36), молекулярный механизм, посредством которого происходит этот процесс, оставался неясным. Предполагается, что аутофагия и антиангиогенный эффект, индуцированный рапамицином, способствуют вирусному онколизу (35, 37). Здесь мы демонстрируем, что ингибирование системной продукции IFN I типа рапамицином является основным механизмом, с помощью которого VSV ΔM51 (и, скорее всего, другие онколитические вирусы) проявляет превосходную терапевтическую эффективность против MG по сравнению с VSV ΔM51 или рапамицином отдельно.Что еще более важно, VSV ΔM51 избирательно реплицируется (и убивает) в раковых клетках, но не в нормальных клетках крыс, несущих MG, которых лечили рапамицином. Кроме того, нормальные клетки требовали гораздо меньшего количества IFN для полной защиты от инфекции VSV по сравнению с раковыми клетками (рис. 1 C и рис. S1–S3). Эти данные показывают, что нормальные клетки, но не клетки глиомы, способны реагировать на низкие уровни IFN и давать эффективный противовирусный ответ. Таким образом, может существовать порог, при котором низкие количества IFN вызывают защиту только нормальных клеток, и дополнительный порог, при котором слишком большая продукция IFN защищает как нормальные, так и раковые клетки от вирусной инфекции.В совокупности наши данные показывают интересную возможность того, что ингибиторы mTORC1 в сочетании с чувствительным к IFN онколитическим вирусом могут быть использованы для улучшения клинических результатов у пациентов с миастенией в будущих клинических испытаниях.

Материалы и методы

клеточных линий и вирусов.

Линия клеток глиобластомы крысы RG2, линии клеток глиомы человека U87, U251, U373, U343, U118 и линия клеток фибробласта крайней плоти человека HFF были получены из Американской коллекции типовых культур.Клеточная линия крысиных астроцитов DI TNCI и клеточная линия фибробластов RAT1 были получены от T. Hebert (Монреаль, Квебек, Канада) и S. Meloche (Монреаль, Квебек, Канада) соответственно. Все клеточные линии культивировали в среде DMEM плюс 10% FCS. Свежеиссеченные клетки глиомы пациентов получали с одобрения Монреальского неврологического института и культивировали, как описано (21). Чтобы создать клеточную линию люциферазы-RG2, модифицированную плазмиду гена люциферазы светлячка (вектор энхансера pGL3; Promega) котрансфицировали в клетки RG2, как сообщалось ранее (38).Плазмида люциферазы светлячка была предоставлена ​​B. Wilson и E. Moriyama (Торонто, Онтарио, Канада). MEF, полученные от мышей WT и S6K1/2 DKO (26), были иммортализованы последовательным пассированием. Описан серотип Indiana VSV, VSV WT -GFP, VSV ΔM51 -RFP (красный флуоресцентный белок) и VSV ΔM51 -GFP (зеленый флуоресцентный белок) (16, 21). Титры вируса определяли стандартным методом анализа бляшек (17).

Исследования эффективности и репликации вируса in vivo на модели ортотропной глиомы грызунов у иммунокомпетентных хозяев.

самки крыс Fischer 344 под анестезией (80 мг/кг кетамина и 8 мг/кг ксилазина, внутрибрюшинно) фиксировали к стереотаксическому аппарату и 1 × 10 4 клеток RG2-Luc суспендировали в 2–3 мкл раствора PBS. были имплантированы интракраниально, как описано ранее (23). Во-первых, чтобы определить влияние VSV ΔM51 и рапамицина на выживаемость, животных разделили на следующие группы обработки через 1 день после имплантации клеток RG2: (i) контроль с раствором PBS, (ii) рапамицин отдельно через i.п. введение за 1 день до инъекции вируса (рапамицин 5 мг/кг пять раз в неделю в общей сложности 2 недели), (iii) VSV ΔM51 внутривенно. введение (5 × 10 8 БОЕ в 100 мкл раствора PBS на 2-й и 5-й день, всего две инъекции, и (iv) VSV ΔM51 плюс рапамицин (та же доза, как описано ранее). Животных в каждой группе ежедневно контролировали и умерщвляли при появлении симптомов (потеря ≥20% массы тела или трудности с передвижением, кормлением или уходом за телом). лобная доля крыс, как описано ранее.Через десять дней животных объединяли в группы и лечили, как описано для исследования выживания. Рапамицин вводили внутрибрюшинно. с 5 мг/кг/день за 1 день до введения вируса. Животных забивали через 24 и 72 ч после обработки. Животных анестезировали и перфузировали 30 мл физиологического раствора, а затем через сердечный катетер вводили 30 мл забуференного фосфатом 10% формалина. Мозг визуализировали in situ с помощью стереотаксического микроскопа с фильтром GFP, затем заливали орнитинкарбамилтрансферазой и делали срезы для иммуногистохимии, как описано ранее (15), или хранили в замороженном виде для выделения РНК и количественного ПЦР-анализа в реальном времени.

Мышей инфицировали интраназально VSV в количестве 1 × 10 8 БОЕ и наблюдали до 8 дней на предмет выживания или умерщвляли через 2–3 дня после заражения для сбора сыворотки или тканей. Сыворотку собирали путем пункции сердца, а легкие удаляли в асептических условиях и быстро замораживали в жидком азоте. Образцы гомогенизировали в 0,5 мл раствора PBS на льду и определяли титры вируса в клетках BHK21.

Количественное определение РНК VSV.

Мозг разрезали пополам, а опухоли вырезали из той половины, которая их содержала.Опухоли, мозг без опухолей и легкие животных, получавших рапамицин, помещали в 1 мл раствора PBS и гомогенизировали с помощью гомогенизатора тканей. Для выделения РНК использовали гомогенизированную ткань (100–300 мкл). Экстракцию РНК проводили с помощью набора Qiagen RNEAsy в соответствии с протоколом производителя. Образцы хранили при температуре -80 °C. Один микрограмм РНК подвергали обратной транскрипции с использованием случайных праймеров. Обратная транскриптаза была получена от Invitrogen (SSRT II). Образцы хранили при 4°С.Количественную ПЦР проводили на приборе RotorGene с использованием 1 мкл реакции RT с использованием SYBR Green в качестве флуорофора и Platinum Taq Polymerase (Invitrogen) в качестве полимеразы. Праймеры были специфичны для VSV-N: прямой праймер, 5′-GCTGCATTGGCAACATTTGG-3′; обратный праймер, 5′-GCTGCATTGGCAACATT TGG-3′. Стандартные кривые были получены с использованием плазмиды pT7Blue-3 со встроенным в нее полноразмерным VSV-N.

Биолюминесцентная визуализация in vivo.

Мониторинг роста опухоли и ответа на лечение в режиме реального времени выполнялся с помощью системы IVIS 200 (Xenogen) для регистрации биолюминесцентного сигнала, излучаемого опухолями.В указанные дни после имплантации опухоли RG2-Luc крысы получали раствор PBS, рапамицин (5 мг/кг внутрибрюшинно в день 6 и каждый последующий день в течение 2 недель), VSV ΔM51 (д 7 в/в, 5 × 10 8 pfu) и VSV ΔM51 плюс рапамицин (4 крысы в ​​группе). Анестезию вызывали в индукционной камере 2,5% изофлураном в 100% кислороде при скорости потока 1 л/мин и поддерживали в системе IVIS 1,5% смесью при 0,5 л/мин. Крыс вводили внутрибрюшинно. вводили D-люциферин (126 мг/кг; Xenogen), растворенный в растворе PBS (15 мг/мл).Затем измеряли биолюминесценцию до тех пор, пока не был достигнут максимальный сигнал или пока сигнал не вернулся к фоновому уровню в фармакокинетических исследованиях. Данные были проанализированы на основе общего излучения потока фотонов (фотонов/сек) в интересующей области во внутричерепном пространстве (39). Результаты визуализации были подтверждены с использованием H&E на 13-й день после имплантации опухоли.

Вирусные инфекции и тесты защиты.

Вирусные инфекции и метаболическое мечение проводили, как описано (13).Анализ защиты от VSV проводили следующим образом: клетки WT и S6K1/2 DKO MEF или клетки RG2 либо имитировали обработку, либо трансфицировали 1 мкг/мл поли(I:C) (Sigma) с использованием реагента для трансфекции FuGENE 6 (Roche). согласно протоколу производителя. Через 6 ч из ложных или стимулированных клеток собирали супернатанты и затем добавляли к клеткам в течение ночи. На следующий день клетки инфицировали VSV ΔM51 -RFP или VSV при MOI 0,1 или 1 в течение 24-часового периода. Для анализа защиты с экспериментом с сывороткой крысиные сыворотки из контроля, рапамицин, VSV ΔM51 и VSV ΔM51 /рапамицин собирали через 48 ч после инъекции вируса (VSV ΔM51 -GFP), т.е.v. при МВД 5 × 10 8 БОЕ. Серийные разведения сывороток добавляли к клеткам RG2, крысиным астроцитам или клеткам Rat1 за 1 ч до их инфицирования VSV ΔM51 -RFP при множественности заражения 0,1 или 1. Показаны репрезентативные результаты для двух сывороток, полученных из каждой группы. Экзогенный анализ защиты от IFN проводили путем обработки MEF WT и S6K1/2 DKO или свежевырезанных клеток глиомы человека и клеточных линий глиомы увеличивающимся количеством мышиного, крысиного или человеческого IFNα/β типа I (Sigma/Biosource) в течение 6 часов. перед инфекцией VSV WT -GFP, VSV ΔM51 -GFP или VSV ΔM51 -RFP при MOI 0.1 или 1. Жизнеспособность клеток измеряли через 24 или 36 часов после инфицирования с помощью анализа 3-(4,5-диметилтиазол-2-ил)-2,5-дифенил-2 H -тетразоия бромида (МТТ), как описано ( 25).

ELISA и HEK-Blue Type I IFN Assays.

MEF WT и S6K1/2 DKO трансфицировали поли(I:C) с использованием FuGENE 6, как описано ранее. Культуральную среду восстанавливали через 6 ч после трансфекции. Продукцию мышиного IFN-α определяли в культуральной среде с помощью ELISA в соответствии с процедурой производителя (PBL Biomedical Laboratories).Анализ IFN HEK-Blue типа I проводили в соответствии с протоколом производителя (InvivoGen). Вкратце, клетки глиомы человека, высеянные в 24-луночные планшеты, обрабатывали 1 мкг/мл поли(I:C), как описано, в течение периода до 24 часов. Для экспериментов, включающих рапамицин, клетки обрабатывали рапамицином (20 нМ) за 1 ч до стимуляции поли(I:C). Собирали супернатант из ложных и стимулированных клеток и добавляли 30 мкл к клеткам IFN HEK-Blue типа I (InvivoGen), высеянным в 96-луночные планшеты, при 37 °C в течение ночи. На следующий день 30 мкл супернатанта клеток HEK-Blue добавляли к 170 мкл реагента Quanti-Blue (InvivoGen) на 30 минут при 37 °C.Колориметрическую реакцию измеряли при 650 нм на планшет-ридере.

Вестерн-блот-анализ.

MEF гомогенизировали в буфере RIPA с добавлением смеси ингибиторов протеазы (Roche), 20 мМ B-глицерофосфата, 0,25 мМ Na3VO4, 10 мМ NaF и 1 мМ PMSF, а затем инкубировали в течение 30 мин при 4 °C. Клеточный дебрис удаляли центрифугированием при 10 000 × g в течение 5 минут при 4 °C и определяли содержание общего белка с помощью анализа BioRad. Антитела S6K1 и фосфо-240-244 S6 были получены от Cell Signaling, а антитела к β-актину — от Sigma.Антитело против VSV было таким, как описано (13). Антитела S6K2 и IRF-7 были приобретены у Santa Cruz Biotechnology.

Плазмидная трансфекция и анализ люциферазы.

Плазмиды, кодирующие промоторы ISRE, IFN-β и NF-kB, связанные с люциферазой светлячка (FL), были трансфицированы промотором TK, связанным с люциферазой Renilla (RL; подарок от D. Muruve, Калгари, AB, Канада), с использованием реагента Липофектамин и Плюс (Invitrogen) согласно инструкции производителя. Экстракты клеток готовили в буфере для пассивного лизиса (Promega) через 48 ч после трансфекции и анализировали на активность RL и FL на биолюминометре Lumat LB95507 (EG & G Bertold) с использованием репортерной системы анализа с двумя люциферазами (Promega) в соответствии с инструкциями производителя.Активность FL нормализовали относительно активности RL, которую использовали в качестве контроля трансфекции. Плазмиды pCAGGS-COOH (пустые) и плазмиды, кодирующие wt-IRF-7 (pCAGGS IRF7A) и конститутивно активную форму IRF-7 (pMSV IRF7-2D), были предоставлены М. Гейлом (Сиэтл, Вашингтон). Плазмиды трансфицировали, как описано, за 48 ч до инфицирования. Для экспериментов по спасению конструкции pBABE-S6K1, pBABE-S6K2 и пустые векторные конструкции трансфицировали в упаковочные клетки phoenix-293-T. Через 48 ч вируссодержащую среду собирали, фильтровали и использовали для заражения МЭФ S6K1/2 DKO в присутствии 5 мг/мл полибрена (Sigma).Клетки повторно инфицировали на следующий день и отбирали пуромицином (5 мкг/мл; Sigma) за 5 дней до экспериментов с вирусной инфекцией.

Благодарности

Мы благодарим М. Гейла за конструкции IRF-7 и Д. Муруве за промоторные репортеры, связанные с ИФН, С. Мелоша за клеточную линию Rat1, Т. Хеберта за клеточную линию DI TNC1, К. Петрекку за глиому человека. образцы, а также К. Листер, А. Сильвестр и П. Кирк за помощь. Эта работа была поддержана фондами Национального института рака Канады и Канадского онкологического общества (Н.С., Дж. Б. и П. А. Ф.). М.К-М. ученый Серла. Т.А. имеет стипендии Канадского института исследований в области здравоохранения и Фонда медицинских исследований Альберты. XL поддерживается Фондом защиты детей от рака Альберты.

Сноски

  • Участие авторов: Т.А., М.К.-М. и Н.С. проектное исследование; Т.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *